TTHERM_00600400

Length: 2550 bp

cDNA Sequence

ATGAATGTAGCTGGAAGAAATATGCTAAAGACGTTTGGCCCAAAAATAAATGAGTTAAAAGAAATTTTTCAGCAATTTAAAATAAAGTAGTAAATATCCTCTTTTGCTAACTCAAATTATTCGAGAAAAGACAATAGCTTTAAAGGAAGACCAAGAACTGTATCATGTGACTTATTTTAGTTTCTTTTGTAGAAGTTTGTTTACATCCACAAGTATAACAACTTCTTCTAAAAAAAAACTTACATCTTTAAAGAGGATTAAGAAGATATTTTAAACGATTGCAATTAAGAGGAATAAAAGTAATTCGAAAAAGATTTTGTTAAATAAGATACCCAAAAGATGACACAATTAGATTAGTAAAATATTTTCAGAGATGATTTAACTAAATCAGAATAATTGAATTGCTATGTGATCTAAGATTAAAGTAACGAGACTAGATATTACTCTGTAAAGATAATTCCAACCTTCATAGAATAACCTTCTATCTTATTATTAATTGAAGACCTTAAAATGAGGAAATAAAATAAATATTTTGAAAAGCAGTAAACAAAGCAATCATAAATTCATAATTTTTTTTTCAGCGATATTCAATAAAAAATTTAGAAACAAATGTCATACATCATTAAAAATAATTTATAGTGGTCAAAAAAGATGTGTATCATAATAAGAAATTAATTACTTTCATACTACCAATCAATAAATTAATCTTTTAAGCTACTCGCTAAAGCTGAAAATTTTAAATTATCTTAAATATAGAAGTACATTCAAGAGTATTTTCCGAATGTTGAGGTAACATTTGAAAATGAATAATTAAAAGAAGAGGAAATTGTTTAAGATTTTCATCTCGTTTCATACGTTCTAACTTGTTTCTTTACTTCAGCTGAGATATACAATAATAGCCTCAAAAAGAATTTGAATAGCACCTAAAACAATAACAGCCAACAAGAATAAATGGATTTTACTAATATTTTCTCAATGCAATAATTCAATTAAAATATGATAGCATCAATAAATCCATAATCAGAAGCTAATAATTCTCCTAGGCCTAGGCTAAACAGCTTTTATGAAAATATTGTTACTTTACCTAATATTGTGAGCAGTAATACAGCTTTAAATCTTGCAAATAGTGCTAATAACTTAAATTTTAATAGTCAGGCCCAAATAAATAACGCGATTATTATGAATACTCAGAGTAATAATCCTAATAATTAATTTTCTACAAATATAAACATTCCTTTAAATACAAATAACTAGTTTTAAGGAAATGCAAACAATTCATACTACCCAAATAGTGAAAAATACATAAACTTAAACACAAATAAAAATATAAACCCTAATAGTAATAGTGTAATTAACTATGATAATTCTCCAAACAGCAACATATATATATCTAAAAATAACAATTAAAGTAATTATAAAAAATAAGAAAATCAAGATAAAATAAACATTATAGTTAACTAAAATTAAAAAAGTGCATTTAGTAACTAAATGCAATCAAATGAAGATAACTGTTTGACAATTAATAATAAATGCGAAATATCTGCAATCGAAATTCAATAAGATCTTAAAGATATGAAAGATTCTAACGATGACATATAAAAAATAATTAAATGTCATATTGTCAAAAAAAAGTAAAAATTGTATGAATCAATTGTATTTTGTTTTGAAAACTATACAAAAGAAAATAATTATAACCTTAATTATACAGATAACTAAATAATCAATAAATGGATTTACCAATAAATCAATAAAATTATAAAATATATAGGACCATGTTAAATAGATTAAAAATAAAATTCTTTATAAATAGAAATATTCACTAATTTAACTATCTTATAAAACAATAAAAAACCAGAAACCTAATTATGCATCAATTCACAAGATTAATCGAATTAATAAATAACATTAGTTAATTTGAAATCAGCCATTTAAGCTACTACAATATTTAAGAATTCTAAATATTAAAAATCAGGTACTGCCACATTTGATGGAGACTAAACCAATTCCTGCTAAAAGTAAAATAGAAAAACAGGGAATAGCTAATAGCTGATCGTTAATCCCTAAGAAAAAGATTTTAATTCTTTGACTATCATACCATCTACATTCCGCGAAAACTTATTGTGTACTGTGAGGACTTAAACAACGTAAAGAGCAAAGCTTTCAATAGACACCGATAATATAGATGCAGGAACTAATCAGAAAGCTCCTTCTCAATAAAGCTAGAATGGTAAATACTAAATCAATTTATCTTCAGAAAAAGGTAAAAATAACCCAAACTACGGTGTTATAAAATCTGACGAACACTTAAGATCAGCATGTCCTAAATCCTCTCATATTACTTAAAATTATCATAAAATTCACATGTAAAAATATGGCAAACTTCTTTCAAAGGAAATAGAAAATGAAAGAATCGTAGAAGTCTCCATGACAGATTCTAATAATATACCTTCTAGACATAGAATCTCTACAGTTACTTAAAAAATAGATGAAGCTAAAAGTGAAGGGTTTCCTGATTCTAACATCAAAAGATATGTATAAACTTACTAATGA