TTHERM_00600720

Length: 1287 bp

cDNA Sequence

ATGAACAAAGTTATTTCATTAATTTTGCTCATTTTAACATGTAGTCATGTTTCTTTTGCGCTAATTAAAGTTAGCATAATAAGAGAATATAAGCCACATTAAAAATATGAAAGATTCCTGAGCTCTGATGCTAATGTATAAGCTAGTCAGAGCAATAAAGTAGTTTCACTTGAAAACTACTTTTAGATGAAATACTTTGGTACTATATATGTTGGTAAGAATTAACAAAAGATGAAAATGCTTTTTGATTCAGGATCAGATACGATGTGGATAGGATCTAAAACTTGCAATACTTGTAGAGATAGTGGCATAAATAATTTATATGACTGTATAGAAACTAATGGCTGTAAGTATACAGGAGACCCTATAGAGACAATTAGATATTTAAAAGGTTAGGTAGATGGATATCTAGCTAGTACCATTGTAAACTTCAGCAATAATAATTCTGCATCTCCTTTCGATTTCAATTTGCTTTTGATTACTAATGTAAAGGATCTAGAATCCTATGATGCAGATGGAATTATTGGATTGACTTACTAGGTAAGCTATAAAAGATAAGATACAAGAAGTCCTTTTGTTAAAGAACTGTTCTAAAGGAAGATAATTAACGATTAAAGTTTTTCAGTATATCTCGGCTTTAAGAAAGATGATTCAGAAATAACATTTGGAGGCATAAATCAAGACAAAGTTAATCCTGGTTCCAATTTCATTTATTATTTAGTACCTCCTATTTAAGCAATGTTTTGGGAAATAAGCGTTTAGAGCTTAATCTTAGGAAGTTAATCTTATGACATGTCCTCTAGTACTACTATAGTCGACTCAGGCACTTCAGTCTTATGTTTTGAGACTTAGACATTCAATAATGTATATGAATTTTTAAAGTAAAATGTAAATGGGCTTTAAAGAAAAGATTTATACTTCACATATAAATGTGGCTAACCTCTTCCAAATATTTACTTTACTATAATTAGTGCAGATGGAAAAAAATACAAATATTCTATAGAATCAGACTACTATACTATTAAACTTAATGGTGATTGTGCTATCCTTATTGATTTGTGCCCAAACAATAACATTCTTGGAGAAGTATTTATGAGAAAATACGTAACCCATTTCAAGTATAATTACAAAGATAATAAAGATGCAATAGGTTTTGCATTGTCTATTGCAGATCCTAAAGATAACTATCTTAATGATTCTGAAAATTAAGATTACACAAAATATTATATACTTGGTGGAGTTGGTGCAGGTAATGTTAATAATACAGATATTAGCTCTAAATCTTGA