TTHERM_00601850

Length: 2217 bp

cDNA Sequence

ATGAGTTAAGTTCAAAGTTAAAATAAGGCTTAGTTATAGGCTCAAAGATAGGTGTAATAAAAGCAGTAATAGCAACAGATTTAAGTAATTGACGCTCAAGCAGTTGCATAGGCCTAGTTGCAAAGAGCTCAGGAATAACACACACAACATGTTTACAAGCAAATCATTAACGAGGAGAAGAAAGTTTTTGGCATGAAGTATCCCTAGCGCAATACTGAGCCTTCTATGTTTGATATACTCTCTTGGGAGGAAAAGAAATAGTAAAAGCAAGATTTTAAGTCCAACCATATCCCAAATAACGAAGTTGATTAATACAAAATCTTGATCAATAAGAGCAGCGGTCATTTCCAAACCGAACAAAGAGATAATTACAGATAATTTTATTTAGACAAGGAAGAAGGCGTTCTCGTTCCAGAGGTTGAACCTGAAGTCTTAGATAAGTTGAGGGGTTAACAATAGTAACTGTTACATGAGCATCATCATCATTAACACTAGCCATAAGTGTTAACAGTAGTATAATAATAGCAATAGGTTAATTAGCAATAGAATCATTAAGCTCACAATCTGCATGGACCTAAGACTAGTTATTAGAGAGAATACGAAATAAGCGATGTCCACAATCCAAACGAATTAATAAATATCATTTAAAAGAATCACAAGCTAAGTTAAAAGCAAACAGAAGCTCTCCTTGAAAAGGCTTAGCAAGATAAGCGTTCTAAGATATAAGTTAATAATTTTTATGAATAAGAACCTGTCTAGCTCATTCACCCTAATGATGATAACGAAGAAGACTACGAAGATGAAGATTAAGAGAATTTAACTCAACAATAATAAATTGAACGCTAAAGATTGAGAGAACAAAGACTCAAGGAAGAAGAAGCAAAGAAAGAAGCAGCCAAAGTTAAGAAATTCTCCACTGTTAACACTAAAAATGTTAAATCCAAATTGATTAAATACAAACCCCAGGCATAAAAGTTAGACCCTCAATACCAAAAGGAAAGAATCGATCGTAGAAAGCAAAGAATTAAACACATGGAAGAAACAACTAGATGGTTGCCAAACAGTGCTTTCACTACTTATTTCGGTAAACCTGCCTTCGAAAACTACGGAAGGGGTAATGTAAATCCCTCTATTGGTGGTCCCATTTACGGTTAATACCTTCTTTCTCACAATGTAAATCCTCATAGAGGTATTCACCAACCTAAGTACATCTAATCTTACAACAACGCTCTTAACTATGGTGAAAGACTTCCCGATTCTGAACCCCAACCTCCCAGAAACGTCAAGGAAGACTTCAGATTGAGCCAAAAATAAGTCGATGATCTTAAGAATAGAAACCCTTTAACAGCTACCGTCAACAAAAGAGAAAATTTGAGAATCTAAAAGCCTGATTTAGTTAACAGTCTTAGATTTGCCTCAAATGAAAACTCTCCAGTTAATGTTGCCAACACTGAAGAAGAAAAGAGAAAGAGAATAAAGGAAGAACTTAAGTAATTGAGAGAGGGCACTAAAGCTCACACTCAAAGTTTCACTCAATTCTAAGATTTTGCAGATTCTCCTCAAAAACCAAAGAAACCATCCATAAAAGAATTGTAAGGAAAGGTGAAACCTCAATCTGCAAGTTAAAAATAAGTGAAGATTTCAGCCTAAGATGAATAACATTAGTAGTAAAATCAATAAAGACAATAAAAGTCAGCAACAGTTGCTACTGCTTAACATTATTAATAGCAACAATAACAATAATAGTAATATGTCTAACAATAGCATTAGTATCAACCATAATAACTCACTGAAGAGTAAATTAGAGCCAATTAAGAATGGGCTGATGACCTTCCTCACAAAAAAATTATTGATGAATTAAATAGAAAGAAGGCTTAAAAAAATAGATTAGCTCTTAAAGTCACAGAAGTTATTCCCGTCCTTCCCCATGACGGTTAATATTATTAAGCTGGTATAACAAGTGAAAAGAAGAATAAATCATTGTCTCCAAGCAGACCTCAAACTGCTCAACCAAGATTCGATATTCAAAGCCTTGATCTAAGTGGACTTCCTATTGAAGTTTAGAACGAACTCAGAGAAAAGCTCAATAATCCTAAACTATACAAGAACGCTCCAGCACAATTTACTAAGCACATTCCTTATGCTGGTAAAACTATTGCCAATAACGATGATATTAAATCAGTTTTCCACTATGAAAACATTCAAGAGGACTTTTGA