TTHERM_00614720

Length: 618 bp

cDNA Sequence

ATGGGAAACGTATGCGGAGGATCTTCACAATCATCATCTAGTAGTAAAAGCTAGAGAGCATTAAGATTAAGGGATGAAAAAAAACCAGCATAATAGGCAAAAGTAGTATTATTAGGAAATATAGCAGTAGGAAAAACTGCAATCACTCAAAGATTTAAATAAGGAATATTTGATCCAGCCCACCAAGCAACATTAGGAGCAGCATACATAGAAAAAAATATTACATTATAAGATAATTCCGTTTTGTCTTTGCATATTTGGGATACAGCAGGAGATGAAAGATATCGCTCAATCCTTTCCATGTTTTATAGAGATTCTTAGGCAGCCATTTTAGTTTATGATGTGACTGATGCAGATAGTTTCAATAGTTTGTAATTATGGATAAACGAGCTTGAAGATAAAGCAAAAACAGAAGGCATGATTATAGCTCTAGTTGGTAATAAAATAGATTCACCTTATGAAATGGTAAAAGTTTCAACATAGAAGGCAGAGCAATTTGCTAGAGAGAAAAACTTCTTGTTTACTGAGTGTTCAGCCAAAACAGGAGAAGGAATAGATAGAATATTTAATATGATAGTTGAAGAATTAATAAAAAAGAAAAAATCAGAGCATAACTGA