TTHERM_00616330

Length: 888 bp

cDNA Sequence

ATGTAGGTAAAGGCAATATAAAATTAAACTTTATACAATCTTATCTAGTTATCGAAAAATGAAAAAAATGATCATTTAAGATAGGCAGTCAGATTCGACTTTGAAACTTCAAAACCAGCTGAAATACTTGAGTTGATTCATGATATGGATTAAAAAGCTATATAAAACGAGTAAAAGTATAAGTTATAAAAAATTAGAAGAATTTGCTTTATTGACTATGATCCTCTTGAGGAAAAAGACAAAAAATTGGAAAAATATCTTCAGTTATTTAGCAATGAGAAGACCTTGGCTGAATATAAGTTTTACTGTCTTAAAGAGGGACTAAATAGTTTTTCTAAAAAGTATCCATTTTTGATGTTAAATAACGATGATTTCGAGAACATAGAAGAAAAGAAGAAAGAAGCACCTAAAGATTCAAGGGATATTTTAAATGATAAATAAAAAAAGGTTTTATATTCTTATAGTTAATTTCCTTTTGAAATAGTAGAAGATGTGCTATTCTTGGGTAATGTATATCACTCAAACAGCTAAATGTATTTGAATGACTTAAGCATCAAGATAATGATTGATTTTATTACATATAGTGAAGAAGATACTTAAAAAATACCTTCTTTTAAGACTGAAAAATTTGAATATAAAAATATTCCCCTTGATGCCAAACAGTCAGTCACCTTAGATTTTGATGAAATTAACAAATATATAGAGTAATAAATCAGTGAAAATAAAGGAAGAGTTCTTCTATATTGTTCAAATGGCTAATCAATAAGTCCTGCATTTGCTATATCCTATTTAATGTACAAACAAAAAATGAACATATAACTAGCAAGCAAAGTGAATATCGCTTAGTGGATATATACTTAATTATTAGTTTACAAACCAAAATATTGA