TTHERM_00621060

Length: 630 bp

cDNA Sequence

ATGAGGTAACCAAATAATCTTAATGAGCTATTTCCTATACCTAGAGAGCATTCTTTAAACTAAAAAACTCCTATAGTTCTAAATGTTTGTGATTAAGATGCTAATTATTAAAAATAACTTGATTAATCTGGAGAAATAGCCAAAATAAATTAATAACTGGAAAAAATTATTTTAGAAAATAAAAATACAAAGGAAAATCGTAAAAATTTAATAGCTAAAATAGTTGCTTAAACTGTCATGGAGGGAGCTTCAAATTAAAAAATTGTTTACAAAACAAGAGGAATATTAACCAAGGTTGGTCGAGCTATAGCCGTAGATTTATCAGATTCCAATTTACCTCATGATTAGGGTATCAAACCTCACATGACAGTAGTTTTTAGCAAGGAACGTTTTACTTAGGAAGACATTAACGAACTCTATTCTTTAGAGCAATAATTCAGAATATCCTAAGGTCTTTAGCAGGATGAAAATTATAGCTTTGTCTTAGAAAACTGGGGTCCAAGATCTAAAAAGATTTAGGGCCAGCTCTATGATCTCTGCATCTATCTTCGTTAGCACTTCACAGGAGACTCAACTGATGAGAGAATTCCTCATGTAGAACTGAAGAAATTAGAGAGAAACAGAAAATGA