TTHERM_00623060

Length: 2526 bp

cDNA Sequence

ATGGAAAAATTAGAAGCATTAGGAACCATGCCTCAAGCTCGTTTTGGGCATACAATTACCTTCATAACAAAAGGAAAGGCTATTTTATTCGGAGGTGCTACAGGTGACACTGGAAGATTCTCAATAACTGGAGAAACATATTCTTTTGATGTGCAAACAAGAATTTGGAAAAAGATAGATACAACTGGAGCTTAGCCTTCTCCCAGAGCAGCCCACGCAGCAGTAGCAGTAGAAATAAATTAGATTGTAGTCTATGGCGGTGCAACTGGAGGTGGAAGTTTAGCTTCAGATGATTTATACTTGCTAGATTTACGTGGCTCTGATGATACTGGTTTATGGACAATAGTTCCAGTAGTTGGTCAAACGCCTGGAAGACGTTATGGCCACACTATTACATATACTAAACCATACCTAGTAGTATTTGGTGGTAACACTGGTTAAGAGCCTGTTAACGATTGTTGGTACTTGAATGTTGAGAAAAGCCCTTTTAATTGGTCTAAAATTGATGGCAGTAAGCAAGAAAATCCCAGAGTTCGTGTCTATCATAGTGCATCTCTCTGTTAATAAGGAAGTGCTAATGGTATGGTTGTTATTTTTGGTGGTCGTTCAAATGATCAATCAGCTTTAAGCGATACATGGGGCTTACGTCGCCACCGTGATGGCAGATGGGATTGGGTACGCGCTCCTTCTAAAGGTGATAAAGATTAACCTACAGGTCGTTATCAACACTCTTCAGCTTTCTTAGGAAAACTTCTTTTGATTATTGGTGGTCGTACTAATAATGTTGGAGAGCATTTAGGTATGGAAGTCTATGATACCGAAACTTCTGAATGGTTACGTTTTAACTCAATCTAACGTTTCCGCCACGGTTCTTGGATTGTTGATAATTCTGTATACGTTTATGGAGGTTTCGAACTTGAGTCTCCTAATATTCCCACTGACTAAATAACTCGTATCAACCTACTTAAAATTTTCTAATCGAACAGTGATCTCACTAACAAGGTGATATAGTACACAAACAACAGTAATAATAGCACTCTCCCTTCATAGCCTCATTCTCCTATTTCTCCTAGTTTGAATGACTCTAGCACAAATGCTAATTCAAATAATAGCTCTATTAGGTCTGGATTTAGTACTCCGAACACTTCCCCTTCTATCTAAGGTCCTGTTTCTCCAGTTCTCATGGCATAATAATAAATGCCTGGTGGATCATACACTATGGGAGGCATATAGAATCCTAATAAACCTAATAACCTTGCTCCTATGAAGCAAACTACTCTTGGAGGCGGATAGATTTAGAGCAAACCACTAACATTCCTTCCTGCATTACAGGCTGATGAAACCAACAAAATGTCAGATATGAAGAAAAAAGGAAAAGTCAATAATATGATCAACTACTCAAATAATGGAATTTACAAGAACCCTACTGATACAAGTGCTATCCATCACTAATTCATATAGCATTTATTATAGCCTAAGATGTTCATTAACCTTCCAGAAAATGTTATTTTTAGATTCACTTCTTAACAAATTATTGAATTATGTGATAAAGCTGAAGATATAATTCGTTAATAACCAATGGTTCTTAGAGTTAGAGCACCTTTGAAAATTTTCGGTGATATCCACGGTTAATATAGTGATTTAATGAGATTCTTTGATTTATGGGGATCTCCTTGTGAAAATGGTTAGGATGGTGATATAGAAAGTTTTGATTACCTTTTCTTAGGTGATTTCGTAGATAGAGGTTCTCATTCCCTTGAAACTATTTGTCTTCTTTTGGCTCTTAAAGTAAAGTACCCCAACTAAATACATCTTATCCGTGGTAACCATGAAGACAAATGGATCAATAATGGATTTGGATTTAGTGATGAGTGTAATCATAGATTGGGTGAAGATCCAAGCGATGATGATTCAGTTTTTAATAGAGTAAATAGACTTTTTGAATGGCTACCTCTTGCAACAATTATTGAAGACAAAATTATTTGCTTGCATGGTGGTATTGGTAGCTCATTACACTATATTCATGAAATTGAAAATCTTCAACGTCCTCTTGAAGTTATTCATGAAGTTAACACCCCTGATTAATAATTAGTTGTAGATATTTTATGGTCAGATCCTACTGAATCTGATTAAGAGCTTGGTATTCATCCTAATAGTATCAGAGATCCTGTTGGTTCTGGTAATATCGTGAAATTTGGCCCTGATAGAGTAAACTAGTTCTTGTAAACAAACAATTTGAGTATGATTATCCGTGCTCATGAATGTGTAATGGATGGATTTGAACGTTTTGCAGGTGGTAAGTTGATCACTGTATTTAGTGCCACTGACTATTGTGGTAGACATAAAAATGCAGGTGCCGTTCTCATTTTAAGAAATAATTTTGAAATTATTCCCAAACTTATTTATCCTTCTGAAGCAGCTCAACAACATTACTGGATTGAAGATGATGAAGCTTTAAAGAAAAGACCACCTACTCCTCCTAGATGGGTTAACAATAATAATAACATCAGAAAATCTTATGACTGA