TTHERM_00624620

Length: 639 bp

cDNA Sequence

ATGAATACATAGATAGAGAGTTTCATTGAGAGATAAAGAAAGAATACAATCCCTCAAATGTTTTAGAATAACTAAAGATATTAATATAATTAAGCAGATATAAATAAGTCTAATCCTTTAGGTTTTTTAAAATTATGGAATTAACCAAAAGTTAAAGAGCAGTTGAAATAATCAATTTAGTAGAAGATGTAATAAGGAACAATTCCTAGCGATAAAATAATTAATGAAAAAATGCTTATAACTGAGTATTGGAGTTAATGGCTTGATCTAAATTAAACAGATTTCTTATAGTTGATTTAAAAGAATCCAAGATTAACTGTATAAGACCATCAAGATATATAAAGTTTGATTTTAGATGAAAATGCAAGAATGGGTAATTGGGTGTTAGGTATGAGTATATTTACATATGGTGTTTATTTCTTGGGATTAAAAAAACATGCTATGTTCTACAATCGCTTTTAAAAGAAGAGTCCATATAAAATAGTAAACTACTCTAAAAATGCTTTGGGGTGTTTATTAGTGATGTCAACTTGGTCAATAATATTAAAATTTTTTTTCGAATAAGCTATCCCAAATCAATTATCAAAAAAGGGATTCTTGAGTAAATACCACATTTTAAAGGAAGAAGTATATTTATGA