TTHERM_00628450

Length: 633 bp

cDNA Sequence

ATGGAAAAGTAATTTGACGTTTTGATAAAAAGATTAAATAACCTTGAGACAATTTTAGGAGAAAATTTGAATATTCAAAACGAGCAAAATGGGGGAGAAATTATTAATCCACTTGTAGATAAATTAAATAAGGCAGAAATAAAATTAAAAGATATAATTAGCAATGTCATAAATGGCGCAACATTTGTTTAAGGATAGAATACAGAGATTAGCAAATCAATTCAAAGCATAAATGAGTTTTTAAGAAACAGCGAAATGAAATATGCAACAGCAATTATTGGAAGCAAAAATAGAGCAGATTTGTTATTAAGATAAGAATAAGAAATTCTTTAGGTAATTGAATTATTAGAGTAAATAGAAAAAAATAGAAAAATGATTTCTTTCGATCCCATCCTACAAGTAGAAGAAAAGAAAAAAATGGTAGAAGCTTTTGAGTTTATGAGTGAAATTTCAAGTTAAGGAGGTCCATTAAAAGTAAACAAAACTAGTGACTAAACAATAGCAGAGACTTATATATAGCAAAATGAAGATATAGAACAGCTAATTAAAGATTAGGCAGATATTATAGATACAATTAATAAAAAATTCCTTTATTTTGATGCAGTCTTGACTCAATTAGAAAACAAAAAATGA