TTHERM_00633390

Length: 4944 bp

cDNA Sequence

ATGGCGAATGAAGTCGAGATAAAATAGTGGTTGAATAGCGACCTAAGAATTGAAAATAAAATTAAAAATTTAGAAGATGATATGCGTAATGGATATATTTACAGAGATATCTTAATGAGATTAGGTTTAAATGTGCCATCGACAATTGTCAACAAGACTGATGATGCTACAATCAAGTAAAATTATTAAATAATAGCAGGAATTTTAAGGGAAAAACTAAAGATAACTTTAATGCCAAAGCCTGGAAATAATCTTGAAGTCCTTAAATAATTAAATAAGTTTCATGTAACGAAAATAGTCAAATAGAATAATTCTACAGTGAGTGATGATGCAGATTAAAATTTAATTGCTTAGTTTAATAAATCTTTAAAAACGAAAGACAGACACCTTAAATCTAGTTTTAAATATGATGAATAAATTAAATAAAATCTTCCTCCTAAAATTATGGATATTGAATAGAAGCTAGAGAAATTTAGATAACAAAAGTTGAAGAGTGAAATTCTTGCAAAAACTTTAAAGGACTAAGAATTAGAAAGGGAAAATTAATGGAGAATTGAACATAGACAATTTGAAATAAACAAAACTCGTAACAATCACAAATATATTGAAGATAAAACTAAAAGCATTTATGAAAATTGGCTTAAAACTCAATAAGTTATGCAAACCAGAATTAATAAAGAATAAACTCTTAATAATTACCTCACTAACAGATTAAAGGAAGAAGTAAAAGCTGTTGAAAATTACGAGTTTAAAGAGTATAAGGAGGGATTAGATTATTTTAAGGAAAATTGTATTCAGTAAGGTGTTTCTTTGAGACATGATCCTGATAATTATAAACCTCCTCCTATTTCTCACTTTAATCTGAATGCCACTATGATGAGAATCAGAGAAAGCACTCACAAATCTATTTTGGCTAGAAAGGATAAAGAAAAAAGAAAGAACAGGATGTTAGTTGAGTAATAGAAATATGAAAAAGAAATTTAAGAGAAGAAAAGATAGTAAGACATGTTGACAAAATTTTGCGAATTAAGTGTTGCTGGAGCAGAGGAAGGAAGAAAGATTTATATTGCTCAAGAGAAAGAAAAGATAGTTGTTAGGAATAGAATTGAGAAGGAAAACCAGATTTAAAAGGAAAGAATGGATTATTTTGACTAAAAGCATGAAGAATTTAGGGAAAAAGCAATCGCAGAAGAAATAGAAAGAAAGAAATAATGGAAACTGCAAAAAGTAGAATACATGGAACTTAATCTCTAGAATAAAATATAAAAAAGGAAAAAACATAGTAAGACTTGTCAAGACTTAATTGATATCATTCTTGATGTCACTGAGCTCTGCCACAATGCTTAGAGATAAAATAATTCAATAAGAGTTCCAGAGTAGTATTGGAGAGATCTGATGGAAAGATTTGCAGAAGGAAGACCACTCTGTGAAGAAAAGGTTGTGACAATATTTGAATAATAATAACAAACATAACGTCAAGCTCACGAAGCTGAAATCTCGGAAGAGCTTGATTAACAGTTATCTATGATGTTTACTGATTACAACCTAGGTTTCTAGATGTGGTAACCTTTTCATTAATTTGAATAGCCAGAAAATCAAATTTTAAATCATGCCTACAATGATGATCAGCTTGGAGATTTCTTGCATTAAGTTATTGACAAAATATATCCTTAAAAAGCTATTTAATCAAAGCCTCATGACATTCCTGATCACATGCCTTTGAGAATCAGCATTATTGGTAATAGATTTTCAGGAAAGAAATCCCTTTCTTAATTAATTAAGTAAAAATATGGAGTTGAAATCATCGACGTATATGATGTTATAGATCAGGCTATTAAATATGCTTTTCCTCCTCCTGAAGATGAAAATGAAAAAAAGAAAAATGCAGCAAAGAAATAAACTAAAAAAGGGTAAGTTGAAGAAGAAAAACCCGATAATCCTCAACTCAGAGAACTTGGATAATAAGCAAACGAAATGAAAACATAAAATATTCCTTATACTGATGAGATTTTAGTGAGGGCTGCTCTTATATAAATAAAATAAATTTTCCCTGTGGTAACACCTGATTAACTCATTCAATAATTAGCAGATGCTAAGATAAAAGAGTAAGAAAGACAAGCTTAAATGAAGAAAGAGTGGGAAGACTACTTAAAAAAGAAAGAAAAAAGTAATCCTAAAAAAGCTGCAGGAAAAGAAGGCAAAAAGAATGTAGGTTCTAAAGTAGAAATAGAAGTAATAGAAGACCCTCCTCAAGAAACTTACGAAGAAGCAGTTTATCGTTTAATGAATCAAAAAGAATTTGAATACACACCAGGCTTTGTGCTGGTTAACTTCCCTCAAAATGTTAAGTAGGCCAAGCTTTTAGAAGAGGGTTTAACAGGATTTGTGATGGAAGAAGAAAGATTGAATCCAGAAGGTGAATAGATAAAAGAATAAATAGCTTAACTTGTTAGAGCAGGAGAGAAGACTCCTGACACCAGTCTTAAATAAGGCGGAATCGATTTGGTGATAAATCTTAATGTCGATGAGACTATTGCAGAAAAGAGAGCGGCAAATAGAAGATTAGATCCTTAAACAGGAAATATATATAATTTAGAAGATAATCTTCCTCCTCTTGAAGAAAAAGGACTTGCTGATAGAATACAGCCAATAGATGATCCTTAAAGCAGCTTAGAAAAAATATAAGAAGCCAACAAATAATTCATTGAAAACTTAGATTATTTGCAAGAATGGTATGGTATGTTCGGATTTGAGACAGAACCTGCTAGCAATTTAAATACAGAGCAATAACAGCCTTAATCATAAGCATAATTATAGTAGAATGAAGATTTGGCATAAGAGCAACAGGAATAGGAAAAAAATATATTTGGAGCTATTTAAAGTTTGGAGTCTACAACTAAAAGAATTGAGGTCTTTGAATAAATAGACAAGAAGCTATCTGATCTGCTTAAAATTAAAAAGAAAAAAATAGAAGAGTAAATCTAAAACTACTAACAAGAATAAGAAAGATTGTAGTAGTAAAGAGAAGAAGAGAGACTCCTTTAAGAAAAGCTAGAATAAGAAAGATTAGAAAAAGAAAAACAATAGCAATAACAATTATAAGAAGCATCTAATTCAGCTAACACTTAATCTAACAATCCTAATGCTTCAGCCTCCCAAGAATAATTGTCAAGTCAAAACAAAATCCCTACTGATAATCTAATTAGTAACGACATGGCTGACACTTCTAAAATAAACTAAACAGATCAATCTATGTAAAACTCAGGATAAGCAGGAGGTGACTTCTTTGACAGACTTAAAATGGACAATTTGAAAACTGTGATGAAAATGTGGAACGAAATATAGACTAACTATTTCAAAGAAATAAAATAAAGCTTACATAAAATAGATAACCATAGAGAGGTTATTTCAAATCGTTTAGCTGATGTATAATTTAGATTCCTTTCGGTTATTCAAAGGCCAGATGATAAATAGCATAAAATAAATACTTTCAAAGACAACCTAAATAAATTCTTTGATGATAATCCACAAATGCTTAGATTCTAAAACACTAAAGATGAATTAAATCAGCACTTAGAAACTTTGTATGAAAATCTATGGGATTCTGTAGAATAAAAGTAAAATAATTAATCAATAAAATCAATAAGCTTGTTTACAAAAATAAAATTAATTTTACTTAGAAAAGCTGAATCAATTTAGGAAAGAAAAACAATCATGGCTTCAGGATGGTTTGACTCTGAAATGGCTGCTCTTTTTTCTTCTTATTAAAGATTTTTCTAGCTAGAATTAAATAAGCTTGAAGAAATTATAGAACTCATTTTATATATCTAAGATGTTGTAGAAGGAAAACCCATTAATGAAGTTTAAGAACATATCATTTTAGATCCCTTCCCTAATGGGCAACCTCCACCAATTTATGATATTGAAAATCCTAACCATTTCCCTAGGGTAGAGAAAATGTTTGATCACTTTATGCATTCAGTTGATAACATCAGCGAGCTTATTGGAGACATAAGAGCTAAATTCTTTAAAAAGAGAACTGCTGGTCTATCGTTTTAGACTATAAACGAGAAGTCCTATCCAGGCTTGAACGATCTCTATAATTAAGTACTCGAAACTGAAAAAGGAATTTGCAAGTATAGAGGATACATTTTGAAATTTACATTAATTAGTAGAATTAAGGAACTTAAAATGATTGAAGTAGCTCTGTACAGCAAATTAGATGATTGGATTATATTTGGTTTAAAGCATGAAAACGAAGTTATTTATGATGCAGTCAGAACTTTGAGATAAGCTATTCAATCTTAAAACCCTGTAGACACTTTGGTTGTGAGTGTTAAAAATATTTCTGACACATACAAAATATTGAATTGCTTCAATCAAATTCCTGCTTATATTCAACCACTCGAACTAGTTGAATCGGTTGATGACTTTAGATTCACAATTTTCGGTATTAAGCTTCTTTATGAAGAACTTCACACTTTATGTGATAAAAGAGACATCATAAATCTAAAAATATTTGAAAATGTATTCTTAAGAAGAAAAAAACATTCAAATCACCTCCCAAAATTCATAAAGTAATTGCCTGATAAATGTTTAGAGAGCATTTATGCAAACTTTGAATCACAAATACATGACGATAAAATAGATTTTAAGGACTTAATGATTTGTTTCATTCTGTTTAGCTCTCCAGTTCCAACTGAAGACCTCATAGAAGAATACAAAGATCAACTATTGACCTACTCAAACAGTGGTTATTTAGAAACACATAATTTCCTTCGTATCGAAGCATGGTTTGACGAATATGAGAGAGATAGACAACTTTATGGTTAGAATTTATTCAACAGAGTATTTTTTGTAAAGCAGCTTTTGTTTGATCTCTATTGCGAAAATGAACCCGTAAATTATTATCATTTTGATTATAATTAATTACACATACTCTGA