TTHERM_00635690

Length: 2535 bp

cDNA Sequence

ATGAAAAGCTTAACTAATTTGATTATCATAAGTTGCGTCATGTTTATATTAGCGGATGCTGCTAATGTTGGTGATTAAATTACTTGTAATAAAGGTGCATAATCATGCGATCTATGTGCTTAAGGCTCAGCTGCAATTTTAAATCTTTTTTAACTTACTGGTTCTTATTGTTAGGTTAAAGATTGTTCTAAAAGCTCTGTTGGAAATAACTTAAATGGCTCAGTTTGTGCCTCTTGTTAAGCTACAGCAACTGATATTACTCCACTAGGTCCTTACTTTGATGGTACTTAGTGCGTTTAAGAATGTAGTCCAGGTTTGTATGCAAGTGATCTAAATGGTTTTAATTGTTAAGTTGCAAATCCAGGCTAGCCAGTTAATTGCTCTATGAGCTAAAGTTGCTATGAATGTGGTTTAAATAATTTCACTATAAATTAATTTAATTTCGACCAAAATTCAAAATTGTGCAATGTCTTTGATTGCTCTTCTAATGCAGCAACTATTTTGAATGGTTGGGTTTGTAACTCTTGCAAATCAGCTACAGGAACTGGTAATATTCCTAAAGGCTAATATTATGATGATATTAATAAAACTTGTGCAGATACCTGTCCTCCAGGTTAATCAGCAAGTGAAGATACATAATTTGTTTGTTCCCCTCCTCCTAATCCTGGTACAGAGGTAGGGTGTTCTACAGACTAATCAACTTGCAGCGGATGCGGAGATAAAAATTAATATTTAAGAATATTTAATTATAAATCTGGTAATAATTGCTCTGTGAAAGATTGTCATGCAGCTACTATAGGACCTTTCCTGAATGGTTGGGTATGCAACTCTTGTAGTTAAGCTTCAGGAGATGGAAATATTCCTAAAGGTTAATATTTTGATGGTACTACTTGTGTAACAAATTGTCCTGATGGATATTCAGCAAGTGCTTCAACAGGCTATACTTGTTATAAAAACCCCAAACCGGTGGCATGTTCTAAAGATTCTTCTACTTGTGCAGGATGTGGGGATACTCCTAGTCTTTAAAATCTATTCACTTACTCAGGTGGAAATACTTGTACAGTTAAAGATTGCTCTTAAAAAGCAATAGGCGCTACTTAAAATGGTTGGATATGCTAATCTTGTAGTGCTGCTACTGGTATTAATCTTATTCCATCTGGTTAATACTATGGTAAATCATGTATTAGTAATTGTGGTAAAGGATATTCAGTAAGTCAAGCTACTGGATTTAACTGTATAAAATAAAATCCAGGTTAATTAGTTGCCTGCTCAAATGATAATAAAACATGTAATGGATGTGGGTCAACAAATGATATTTAGAAATTATTTGCTATTGGAAAAGGGTCCACTTGTGGTGTTATTGATTGCTCTTCTGTAATAGTGGGTTCTAATTTGAATGGTTGGGTTTGCAACTCATGTTCAACAGCTGTAGGAACAGGAAATATTATTTCAGGTTAATATTACGATGGAACAAATTGTGTAACAACTTGCCCTATCGGTTCAAATGCAAGCAAGGATACTGGTTTTGTGTGCTTATACCCTCCTAGCCCAGGTGCTTCTGTTGCTTGCTCTAGTGACTCTTCAACTTGTGGAGGTTGTGGAACAACAAGTAGTATTTAAGGCCTATTCAAATATGGAACAGGGAAAAACTGCTCAGTTACAGATTGTAATTTGATGATAGTAGGGTCTAATTTGAATGGTTGGGTTTGTAATTCTTGTAGTTAAAGTTCTGGAGTTCATAATATCGCTAAAGGTTAATATTACAATGGTAAGACTTGTGTAGATAGCTGTCCTACTGGTTAATAAGCAAGTATAGCAACAGGTTATGTTTGTTAAAATATTCCTAATCCTGGTACACCTGTTACATGCTCTAATGATTCTTCTACTTGTGGAGCTTGTGGTTCAACAAACACTATATCAACTTTATTCACTCACGGAACTGGAAATAATTGTTATGTATCCGACTGTACTGCATCAGTAGTAGGATCTAATCTAAATGGTTGGGTTTGTAATTCTTGCAGCTCAGCTACTGGAAGTGGAAATATTACTACAGGTTAATTCTTTAATGGTACAACCTGTGTAGCAAGTTGCCCTCCAGGATAATAAGCAAACTTATCTACTGGATGGGTTTGTTAACCTATAATAGCTAATCCCGGATCTGATGTTACATGCTCTAATGATTCTTAAACTTGTGCAGGTTGTGGATTAACAAGCGATATTCAAAAATTATTCATTCATGGAACCTAAAACAAATGTTCTGTTGTTGACTGCTCAGCTGCAGTGGTAGGGTCTAATCTGAATGGCTGGGTTTGTAACTCTTGCAGCACAGCTAAAGGGCAAAATAATATAGCTACTGGCTAATACTACAATGGTACAACATGTGTAGCAAGCTGTCTCAGTGGTTAATCAGCAAGTGCATCTACTGGATATGTGTGTAAAGCAGATTCCAGCCCTGCTCCAGTAAATAACAATGCATCCCAATCAAGCATAATCTGTTATGCTTTAGTATTTGCAATGTTAAAACTTTTAATTTGA