TTHERM_00635710

Length: 3138 bp

cDNA Sequence

ATGAAAAAGTTTGCTAATTTAATTATCATAAGTTGCTTCATTCTTGCAGTAACAAGTTAACCTCCTATTGTTGGTAATAGCTTAGAATGTAATTTTAATGCCTAATCATGTGATAAATGTGCTTAAGGTTCTGCAGCAATTCTAAAACTATTTGATTATGTTAATGGCTTTTGCAGGGTTAAAGATTGTTCTTAACTTACTATTGGAAATAACTTGAATGGCTGGGTTTGTAATTCTTGTAGTTCAGTCTCTTAAGTACCTGGTATTATATCATAAGGATAATATTTTGATGGTACTAAATGTGTTAATTAATGTAGTCAAGGTTATTTTGCAAATAAAGAAAATGGCTTTGTTTGCTAATTAGCAAATCCAGGTTAACCTGTAGATTGTTCTTTTGACAAAACAGGCTGCAAAGCATGTTATTTTTTTATTAACTAAAATAATTAATTTAGTTTTGATAAAAATTCATAAATGTGCTTTGTTAATGATTGCTCTTCTAATGTAAATTCAAAATTGAACGGTTGGATTTGTTAATCTTGTAAATCAGCAAAAGGAAGTGGTAACATTCCGAAAGGTTAATATTATGATGGTTAAACTTGCGTAGACACTTGTCCTCAAGGTTTATCAGCAAGTCTAGATACACAATTTATTTGTTAACCTCCACCTAATCCAGGTAAAGCTGTAGGGTGTTCTAAGGATTAATCAACTTGTTAAGAATGCGAATTTGATTCTTCAGTTTTCAAATAATTTGCTTATTAATCTGCAAATAACTGCTATGTGAAAGATTGTCATGTTACAGCTTTATTAGGTCTTTCGAGTGGATGGATATGCAATTCTTGTAGCCAAGCTTAAGGAAAGGGAAATATTCCTAAAGGTTAATATTTTGACAATAGGAATTGTGTAACAAATTGTCCTATTGGGAAATCTGCAAGTGCTTAAACTGGATTTGAATGCTTAGCAAACCCTTAACCTACTCCATGTTCTCAGGATTTTTCAACTTGTACAGGATGCGGAGATACTGCTGCTACTTAATAACTATTCACTTATATAAATGGAAACAACTGTGCTGTTAACGACTGCTCTATTACTACAATAGGCTCTAATTTAAATGGTTGGATATGTAATTCTTGTAGTACTACTGAGATTCCTAATACTATTACAAAAGGCAGATATTATTACAATAAAAGCTGTGTAGATACTTGCCCTAGTGGCTATTAAGCTAGTGCAGCTACTGGATATAACTGTCAAAAAATTAATCCAGGTTCAGATGTTAGCTGCTCAAGTGGAAATTAAGCTTGTGGAAATTGTGGTTCAACAAGAGCTTAATAATTATTTATTTCTAGTAATAAAGGGTAAAGCTGCAAAGTTAAAGATTGCTCTTCTACAACAATTGGTTCGAATTTGAATGGTTGGATTTGTTAATCTTGTTTATCAGCTTCGGGTACAGGTAATATTGCTTCCGGTTAATATTTCGATGGTAGAAGCTGTGTAAATACCTGTCCTATTGGTTCTACAGTAAGTAAGGATACAGGATATGTTTGTTAATTTCCTCCAAGCTCAGGCAATCCAGTTCCATGCTCTAGTGATTCATAAACCTGTGGAGGATGTGGAACAACAGATGATATATAAGGCCTATTTAGTCGAGGAACTGGGAATACCTGCTAAGTAACTGACTGCAATTTGAGTGTAGTAGGATCTAATCTCAATGGTTGGGTTTGCAATTCTTGTAGTTAGACTAATTCAGATCATAATATCGCAAAAGGTTAATATTACAATGGTACTACTTGTGTAGATACTTGTCCTAAAGGTTAATAAGCAAGTGCAGCTACTGGATTCGTTTGTTAATATCCTCCTAATCCTGGATCTTCAGTTACATGTTCTAGCGATTCTTCTACATGTAATGGATGTGGATAATCAAAAAATATTTCAAGCCTATTTACTTATAAAACTGGCAATAACTGCTCAGTCAGCGATTGTAATTCTACAGTAATAGGATCTAATCTGAATGGCTGGATTTGTAATTCTTGCAGCTCAGCTTCTGGAGCTAACAATATTGTAAAAGGTAAATATTATAACGGTATAACTTGTGTAGATAGTTGTCCTGCTGGTTAGTAAGCAAATGCGGCAACAGGATTTATTTGTAAAAATATTCCTAACCCTGGTACTCCTGTTGCATGCTCTACTGATTCTTCAACTTGCAATGGGTGTTTTTCAAATCTTGGCTCAAGCATATTCACTTATGGAACTGGAAATAATTGTTATGTAACTGACTGTACTGCCTCAACATTAAGGGAATATAATGGTTGGGTTTGTAATTCTTGCAATTCAGCTTCAGGAGATGGGAATATTGCTGCAGGTTAATATTTTAATGGTAGGTATTGCGTATCAAGTTGTCCCTCTGGGTAATATGCAAACTTATCTACTTAATATGTTTGTTAACCAATAGTAGGTAATCCTGGCACTCCTGTTACATGCTCTAGTGATTCTTCAACTTGTGGGGGATGTGGTTAAACAAATGCAATTTAAAATTTATTCACATTTGGAGTAGGAAATAGTTGTTTTGTCGTTGACTGTACTGCTTCTACAGTAGGATCTAATCTAAATGGTTGGGTTTGCAACTCTTGCAGTTCAGCTACTGGAAATGGAAATATTACTGTAGGCTAATATTATAATGGTACGACATGTGTAGCAAGTTGCCCCCCTGGATAGTAAGCAAGTTTATCTACTGGATGGGTTTGTTAACCTATACCAAATCCTGGATCTAATGTTACATGCTCTAATGATTCTTAAACTTGCGCAGGTTGTGGATTAACAAACGATATTTAAAAATTATTTACTCATGGAACCTAAAACTAATGTTCTGTTACTGACTGCTCCTCTGCAGTGGTAGGTTCTAATTTGAATGGTTGGGTTTGTAATTCTTGCAGCACAGCTAAAGGACAAAATAATATAGCTACTGGCTAATACTACAACGGTACAACTTGTGTAGCGAGCTGTCCTAATGGTTAATCAGCAAGTGCATCTACTGGATATGTTTGTAAACCAGGCTCGAGTCCTGCTCCAGTAAATAATAATGCATCATAGTCAAGTATAATCAGTTATATTTTAGCATTTGTAATGTTAAAACTTCTAATTTGA