TTHERM_00637050

Length: 1992 bp

cDNA Sequence

ATGAACAGCAATCGATATTATAAAGAAGAAAAATCTAAAAGTAGGAAGTAAGGACCAAGAGTGTACACTTACTAGAATAAAGATATATCTTCAATTCAACAATAAATTGTGGTGGACCTCTCTTAGTCTTCTTATAGTTAACCTTAGACCTTATATGATGATGACTCTATTTACACGTTTTGCTAATCTTAGAATAAAAAGCAAGCTAAGCATTTCTCTACATAGTCTGTTTCAATTTCAGTTGAAAACAGCTTAGACAACAATCTTTAATTAAAAGGATACTAAAATAGTTTTTAGTCCTCAGTAAGCATAAAAGTTTCTTCTTCCAATAATTAGCCTAAACCCAATAAAAACAAAGGTAAATAGGAAAACAAAAAAAATAATAATCTTAAAAAGTGTACTTCTCTTAAGTCTATTGTTGATCCCCTTAGTGAACAGTAGGATAAAAGCGCCTCCATTTCTTCCATATCTTTTTCAAACTCAATAAAATTTGAACCTAATAGAAACAAGTTTTAGTCATCTGTTGATAGTATTGATTCCTCTAATAAGCGTTTAACTAGATCTGCTTCTTAAAATTAGAATTAAATTATCTTCAATAATATTTTTAGTGGCATGCAACATATTAAAGACAAAATGATTCAATAAAATATTTCCAGTAACACTTCCTCAAGGATGGCAAAAAAAAATATTACAAAGGCAGTCGGAGTGTAGAACTTGAATAAAAGTTAGAATAGTATATTGAACTGTAGTACAATTACTGATAGCGATATATGCTAAATAGAAAAGACTAAATATAAGAAGAAAGGCTATAATAATTCCTAAGAAAGTAGTGTTGAAGCTTCTAAAACTAACTTTTTAGTTGGGGCAGCAAGCACAACTCAGCCTAAGTAACGTAAAAATGAAAAAAATTATTCTTAAGAAAATGAACTTGATGATGATGAAGAAGATGATGAATTATATTATCTAAGGTAAACAGCTAAAGCATATGATAATAGAAAAGCTAATGAGAATAGATTTGTATTTGCTGATGAAAAGGATTACAAAAATCTTCAGAATTAAAAGATGTTTGATGAAAATTCAAAACCATCTTTCAAAATAGTAAAAAAATCAAATAATATTTTCAACGATAAAGCATGTCTTAAAAATGAGACAAAAGATAGCTCATACATTAATTAAGGAACTAGAAAAGCCGATTCTGCTTAAACAAGTGTAACTTAATGCAAAGAATAGTTAGAGAGGAATTAGTAATCTAAGCTCTTTGAAAAACATTAGAATGGAACAAAAAAGGGTTTAGATAAAGCACCATTTTTCTTTTTTGATGAAGATGAAGATTTGAGATTTTCAAATAAGTTAAGTAGCTTAAAGTCCTAAGATGAAACTCACTTAAACATAGATGATTAAAATATTTGGAATAAAAACTCATGTTTAAACCATAACAGTTCAGAAAAAAATTAATATAAACAAAATAATAATAAATTGGATTTTTTCAATATAAAACAACTAAACAATTAAAATATTTGGAATCAGGATCACGTTAATGAAACTGAATAAATAGATTTAAATTAAATGTTCTAAAAAAGGATTAAAAACTCTTAACAAAATAACTAGTGTTTTGGAGTTGATAGTGCATTTACAATAGATTATGAAAAATTAAGATATACTAGTTAAAACAGCAATAGGATAAGACACTACGAATTTAACTGTTTTAAGGATAAAGATTTACGTATAGATCAAAAATTCTAGAAAAAAATTTAAGAGCTAACTCTTGACGATGATAATCAAACAGACGACGAAACTCTTGATTATTATGTTGAAGTTTGTTTTAATGATTTGCTAGTAGGAATAGAAATGAATAAATCAGAATCATAAGAATTTTATGGAGAATCTGAAAGCAATTCTTCTTCATCTAATTCTCAAAACAGCTCAAAAAAAATGGACCCATTATGGAGATACTTCAGACCTCCAAACCATAGTGAAATTGTTGAAGCATGA