TTHERM_00641240

Length: 936 bp

cDNA Sequence

ATGATCGGAACTTTCTTCAATCGTTTCTCTAAAAATTTGCACTCTATTAGCAAATACAATTTTACAAGCAACCCTGAAGCCAAATACAAGATTGTCCTTTTGAGACACGGTGAATCTGTTTGGAATAAGGAAAATCGTTTCACCGGCTGGAAGGATGTCCAACTCTCTCCTAAAGGTATTGAAGAAGCCAGATCTGCTGGTAAGACCTTAAAGCAAAACGGTTACGAATTCGATGTTGTTTACACCTCTGTTTTGACCAGAGCTATCATGACTTATAATAACTTAGCTGATGAATTAGGTTGCCACCATTTACCAGTTATTAAACACTGGAGACTCAATGAAAGACATTATGGTGCTCTCTAAGGTTTAAATAAGACTGAAACTGCTGAAAAGCACGGTGAAGAACAAGTTAAAATATGGAGAAGATCTTACTCAACTCCTCCTCCTGCCCTTGAACTCGATGATGAAAGATTCCCTGGACACGATAAGAGATACAAGCACCTCCCCATTCAAGCTTTACCTAGAACTGAAGCTTTATCTGACTGTGTTGCAAGAGTTATTCCTTTCTGGTATGATTAAATTGTTCCTTCTGTCTTAGCCGGTAAAAACGTTTTAGTTGTTGCCCACGGTAACTCTCTCAGATCTATCGTTAAGCATGTTGATAATGTTTCTGAATAAGATATTATTGGTATTAACATCCCTACCAGTGTTCCTTTAATTTATGAATTCGATGCTAACTTCAAGCCTATCAGAAACTACTACTTAGCTGATCCTGAAGAATTAAAGAAGAAATAAGAAGCTGTTTAGAACTAGGATAACTAGCTTAGTTAAATTGAAATTTAGAGAGTTGATGATGCACTTTTGAGAAAGTTGAGAGATGCTAAAATATATGGTCTGAGAATGGAACTCACTATTCAATTTATGATTGAACTTTGA