TTHERM_00644610

Length: 558 bp

cDNA Sequence

ATGCAACAAATTGCTGAATCTCAAAAAACTAAAAAGGAATATCGTGATGCAGTCTTATTTGAAGAAATTTTGAATACTTAAAAAATTATTCCCTTGTATGATTGCTATGGAAAAGTATTTAGACATGAATTGATAAAAAATTTAATTTTTGTTTTGGGTGGCTTTGGAATTTTGTACTATTTCTACAATGATCCTGACTCTAAGCCTAAAAAGAAAACTTTCCTTTGTGCTTTAACTTTGTCTTTTATTGCAACTAGAGTTCTCACTTATCGCCGTTTATAAAAGAGTTTTGTTGATAAGATTATTTATGATACTACAACTTAAATGGTCACCTTGACAAAAAGGACTTTTTATGGTAAAAGATTTGACCAAGAACTAAACCCTGCTTTACTCTTATTTACAAATGACAAATCTTTGAATATGAGAAATATTAATTATATAAATATGGAAACATTAGAAACTTATCAAATTGGATACGATTACGCTTGGAAAAACAAGGCCCTATTTTCTCACATCCTAGAATAAAGAATAGAAACTATCAGAAATAAAAAAAATTGA