TTHERM_00647510

Length: 4500 bp

cDNA Sequence

ATGAACTAGGCATATTAGTATTCTTAACAGTAAAACTCAGCATAGATTATAGGCTCTAAAAATCAGAAGAAGAATTTCCCAAACACAGTCAAAAAGCAATAACAACTGCAAGAAGAGTATGATGAAATACTCTATTCTGAAAATGCTATCTAGTCTAAAAGAAAGCTTAAGAAATTAATATAACAGAATTCTGGAAATATTAATATCGTCGATGATGTTAGGGATATAAATAAGGCTAAGGAATAGGTAACTTCAGGCTTCTTCCCTAGCTTTGCTAGCTTCATTCAAAAAATCAAATGCTTTAGCTTAAAAGATAACATAGTCAACTACTTGAAGAATAAGTAAGCCGAAAGACAAATTTTAGAGTAGGAGATTAACAATTTAGATATAAATGCAGGTAAATAAGCCCAAAAAAATGAAATGGTAGCTGAAATTAATCAAGAATAAAAGAAGAGCAATTAAATTAATAACTAAGAGACTCCAAGAAAGTAAAACCTCAACTAACCCAAATCTAGCAGATAGTCTTCATAATCAGTTATTAGTAATTCTAATTTGCAGCAGTAATAATAGTAGTTGAATTATAAAAAAACTTAAAATAATGTAGTCATTCACTACAACACATATAATATACAAAAAGAATAAAATAATTCATAGAAAAATGTGTAATAATTTAATCAACAGAGATAACCAAACTAGGATTAGCAATATTAAATACAATATAGCCAAAATAGCTCTTCTAGCAAATAAAGCAAATAAATTTATTAAACAAACTAGTATCAATAAAATTATATTAATCAGTAGCCACAATATTATCAGAGCGCGAATTAAGTATAAAATTTGAATGCCACTGCTATTTAAAGGCATATGCCTGAGGATGTTATGAATTAATCAGAAAATTCAGTCTTAAATGGATTTAAATATAATATAAATCATTAATCTTCAAGAATTCCCTCTTCAAACATAGGAAACCACAGTTCTTTCAATGCTAGATATACTTATTAAGGATCAAGCTATACAAAATAAAATATCTTACAAAAGATTATAGTCTTTTATGATAATAAATACATTAAAGACTAGTAAAATAAAAAGAAATTGCAAAATAAAAATCTTCAATAAACAAACTAAACTATGACTTAAGAGGATTAAAAGGTCAAAGTACTCAAACCCATTGCAATAAATCCATATAATCTCAGACCCTATAGTTCTGTTGTCAAAAAAGAAAGTAAAATTATTGATATTGAAAGAAGAGTAAAAGAATAAGCATAAATGCAAGTAGAAAGATTATAAAATTAAGAGAGATACAATAATAGAGTAAATTGGTCACTTGCAGAAAATACCAGGGCAGCTTAGATGAATAATTTTAAATTAACTGAAAATGAAGAGGATAGATATAAGAAACAAAAAATATTGAAAGACCTTCACAAAAAAATGAAAGAAAAATAAAGATATATGTTAAATGAAGATGATGACGAAGATGAAGAAGACCATAAATCTAATGAAATTGAAGAATATGATTAAATCTTAGATAGTTAACTCTAAGATTAGGACTCTAACATGATATATAGTGTGGATTCAAACAAACCATAAAGGCATATTATTGCTAAGAAGAATCAACAAGGCAACCAAGCAAATGCAAATAAAAAATCATCATCTTCAAACGATGAATTTTAAACATCTTGTTCATCTGATGATGACGGAAAAAATAAAATTAATGGTTTACATAAGAAGGGTGCTCGCCAAGGACCATCATCTTTGTATCGTTCTCCAGTGCCTTTTATAGGAGAACTAAAAGAAGATTTTTAAAACATGATGCTGAAAATGACAGAATCTCAAGAAATATTTGATTTATTTGTTTAGTTTTTAAAGAAAATATAAAGTTCTGAAGGGGCAATTAACATTTCAGAAAAATAATAACAAGAAATAAAGTAATAGATTTTACAACAGCTCTAATAAAAAGATGAGAAATTGAATGGATCTATTGATTTTTCAGAAGTAATTAAGAATAAAGAAACTATTTTGGCAAGTAATAAGAAAAAACTTTCTCCAATTTAAGAAAAGAGCAACAATAGTGAAAATAAGAACTTTAGTATTGATTAAATTTTCAACAACTCTGCATCAAAGTAAGATGACCTTTTACAATTTAACTAGAAATAAGCCCAAGAAACTGTATTTTAAATTAATGGAAGCCAAAATAAGAATTAAGCTTAACCAGTTAGTGGTGTCAGTAGCTCAGAAAATACTCTTCATAATCAAAACCCTAACTAAATTTAAATAGCCAGCGAAATTAATAACAATTTATTCTAAAAGAACTAAGCAAACAACATATTTTCAACAATAAATCCTAGCAATCAAAGCAACAGTGGTATTAACTTAACTGCTAATAAAGAAGTTTCTAAAGTTGAAGTTAAATAAATAGCTTCTGATGTTGCTTCAAATATTTTTGGTAATTAAGATAAGAATTAATCTTAAACTGAGGAAAAATCGGAAGAAAAAAAATCAGTTTTAGGGCCTAATATATTTTAACGTATAGATAACCCTCCTAATAATTCAACTTCAGGCAGTGAGGAAAAAAGCCAATTGAATAATTAAAATTAGGAAAAATCTTAAAAACAACCTGCTGTATAACCTTTAAACTTATTTGCTAATTCTGGTGTAAATTTATTTTCTGCATCCAAAGCATCTTAGAAAGACGAAAAAACAGAGTAATAGAAACAGAGTGATAAAGTGGAAGAATAAACTGAATAAGATTAATTAAAGAAAGATAATGAAATTTTAAAATCACAGTTAGATATAAGAAGATCTGAGTCTTTAACATCAAAGTAAGCTTAAAGTAATAACAATTAACAAGAAATTACATAGTAACCCACAACTTAAAATGCAACTATTACAAATAATTTAGTAGAATCTTAGGTTTTGTAATAAGACTCAAAGAAGAAAATAATTCCTCTAAAAATTTCAGACTCAAAGAAAAAGGACTAGCAAAATGCTCCTGGCTAAAATGAAGCAAATAATGACTAAAAAACAAATTAAACTAACACACCATCTATAAATCTATTTGCTCCAAATAATTAAGCTTAAGGAGTGAATATATTCGCACCTAAAACTGACAGTAAATCTAAAGAAAACGCTTAGCAAAATTAGCAAACAGACTCAAAATAGAAGAGCCTCTTTTCTTAGAATGCAGAAAATTTATTTAATAAAAATACTACTTAAACATAATAAGACCTTGATAAAAAAACTAACATTTAATCTAATGATAGCTCTGGAAATCAAAACAAAAAGACAAACAGTCCTCCTAACAAGACAACAAATCCCTTTTAACAAGCAACTTAGAATCCATTTTAGCAAACAACTTAGAATCCATTCTCTCAACCATCAAATAATCCTTTTGCTGGCTCTTCACAACAGAATAATTCTAATAACTAAGCACCAAAGCCTTTAAGTCTTGAAAGTTTAGTTTCCTAAAATAAAAACATGTTTTCAAATCAACAACAAACAGCTACTAATTAAACTGCTAATAATCTATTTAGTCAACAAAATAACATATTTGGGAATGTTTAATAATAAAATACAACAAATAATAACACAAATACTGTTAGTAACAACGCCAATCCCTTTTCAGCTAAGAGCACTCCAACATCAAATAGCTGGTTAAATAACTAAAACACTAATAATACTCTTAATAACAACAATCCATGGAATTAAAACAACACTTAGTAGCAAAATTTATTTTAAAATAACTAAAATAACAACTTATTTAACCAACCCAGCAATTAAAATGTATTTAATGCTTCTCAAAATAAGACAGATGTGTTTGCTAATAACCAGAATGGTAACAACATTTTTAACACAAATACCAATGTTAATAACAATAACCCATTTTTGTAAAGTAACTAAACCAATCAAAATAACTAAAATAATGCCAATAGTATTCTTAACTAATCTTTTGGTAATGGAAGCAATAATATGATTATTGATAATAATCAAAATAGTAATTGGTAAAATTAGAATGCCTTTAACAATAGCAATAATGGAAAACCTTGGAATCAATAAAATAACAGTAGCAATAACTACAATTTCGATTCAATGGGTATAGAAAACCCAATGAACTAGAGTATGAGCCTGGGTAACAATGGCTTTAACACCAGTTTTGGAAACAATAATGGTAACAACTATTTTAGCCAGAGTAACAATTACAATTAGATTAATCCTATTAATAACTAACAATTTTATGAGAGTCGTCAGACAAATTATTTATCCTAAAATGCAGGAGCAAGTACTCTATTTTCAAAACCAAGCACTCCTCTAAATGTTAAACCAGTAGTAAATACTCCAGCACCAAATAACAACGTCAATGTTTAAAGCTAGTTAAATGATTCCCAAGGTTAATCATCAATTTTTTTCGACAACCAAAATAAAACAAAAGGCAATAGAAAAACCGAATAAGCCACAAGAGTTTCAAAGCTCTTGGGACATAATTAAAACAGTAAAAGAATATGA