TTHERM_00649420

Length: 1179 bp

cDNA Sequence

ATGTTTTCAAAGGGTTTATTAACAAAAGTTTTAGGGAAGAATTTATTTAAATAATGCGGTCTTCATAATACTTTAAAGTATGGATTTGCTTTCCCAACTTAACCTTCAGACTACGCTAATTTGAAGAAGCTGTCATAACTTATGAATGCTAAAGTAAGCTTTCTTACTTTGACCAATGATAAGATCTTTTCTTTGATTAGTTAATTCATCACTATCAAGCAATAATTAGATATTAATGAGGAAATCGATTATGATGGTTAAGTTAGATTAATTAATTCCAATAACAAGCAATTAGGTGTCATGCCCTTCGAAGAAGCTTTCAATAAAGCCAAAGATATGAATTTAGATATAGTTCTCGTTAATAGCCAATCTAACCCAGTTATTTGCAAAACAGTTAACTATAAAGAAGAAATTTACTCCAAATTTGCTAAAGAAATTATTTCTTAAGAAGCTGAATCACGTAAGGTTGATAGCAAAAAGCCTAAAAAGTAGATCTAGATATCTATTAACATTTCAAATGCAGATATTAGAACAAAGGCATAAATCTGTAGGGATATTTCTAAAAAGAATCCATAGATTAAAGTCTTCATATAAACAAATGATGCCTAAGAAGATGAACATGACTTGATGGTTAGAAGTTTATTAAAAGACGAATTAGATTCTGAAGATTTATTTAACGATAAGAAGGCTACTAAGCAAGTTGAATTGCACTTATAAACTATTGAATTCAATCAAACTTAATCAACATACTCTACTGAATTAATTAAAAAGCTTGTTGATTAATATCTTAGAGAACTCAACAATCCTAAGAAAGATGATGCAGTCATTGAAGAACTCAAGACATCAAGTAAAACTCTTAAGCAACTCGAAAGATTTGAAAGCAACAGCAAATTGTTGGTTAGTGAATAGTCTCTTGAAGAATAAATTAATGAATTCGCTAAGGATATTAAGGATGAAGAAGAAGATGAAAATATGGATAAATATCTTTCTGCCTTAGAAGAAATTTCAAAAAGATAGAAGAGATCAATTCATGATATTTAGGATGAAATCGATAATTTAAGATTTAGACTTTAGACATCAAAAGAATAGGCTTTGGTTCTAAGTTTGTTAGAAAGAGAAGAAAAGCGTCTTCGTGACTACAAGAGAACTTTAAAGCTAGCAAAAGCTGTTAGAAATTGA