TTHERM_00656140

Length: 507 bp

cDNA Sequence

ATGGAAGACTTGAATTAAAAAAAGGAGTAGCAAAATAAAGATTAGCTGAATTTATAAAAGCAAGAAGAAAGAGAGTCTGCTTTTAAGAAGCTTTACAAGGATTATGTCAATTAAAAATAGAATGAAATCAATTTATACAACATATTTAAGAATAATGTATTATTGGAAGATTTTACATATTCTAGAAGGTCCGCGCTAGCATTCATATTTGTTCCTACTTTATTGAATTTATATTATATTTGGAAACCCTATAGCCCTATGAAGAATACCTTCAGAATAGGCACAATTATAGGCTGCTTTCTCCACTTCAATTATGCTTTGAAAAAGGATTTTAGAGAGTTAGTAAAGAAAGATACAGAACTGGCTAATAAAGCAAGACTCTACGCTTAAAATATTAGTATAAATAATCTTTCAGTGAGATCATTCTAGAAGGAAACTAATGAAATCGCAGATAAAAGAAAGCAAAAAATAGAACCAGTACAAGTTTAAGATATCCAAAACAAATGA