TTHERM_00657360

Length: 585 bp

cDNA Sequence

ATGATGAACTTTTAGAGGCAACAAGATATAAACGCAGTTGATTTCTTCGGATATTACCATTTGATGAATCAATTTGTTATAAGATCTTGCAAGGATTAGCTTACAAGTATTTAAGTTAAATAAAATTCACTTTTTGAAGTAGGGTATAAAATTGGGAGAAGTGTAGTTGAAAAAATTACAGAAAATTGCTTAGATAAATTCAAAGAAGATGTAGAAAAGAACAATGCAAAATGTCTTCCTCAAATTAAATTTATTAGCAAAGATTTCTGGAGTTATTTATTTTAGAAAGACGTAGATAAAGCTAATCATAATCTCAAAGGAACATTTTATTTGAAAGTATTTACATTTACAATGTTTGAAAAGCTATCAAACACAGAGTCTCCCGAAGTTTAAGAATTTGTCAGTTTATGGTACTAAGTTATTAGAGGATTAGTTGCTGGAGCTATGAAGGGATTATCTTACCCATCTGAGGTTTCAGTTGATTCTGTTCCTCCAGAAAAACCAGATCATATTTAACCATTTATGATATCTATTCAAATATTAAATTATCCAGCACTGCTGTCATCTCAAATTTAGCAAAAGTGA