TTHERM_00660330

Length: 2262 bp

cDNA Sequence

ATGCTTAGTAATTGCTTGACAAATAAAAAGTGTAATGTTCATCCTGAAAATAATGCATAGTTTGCATTAATGAAAAAATCAGAGTCTAATTAAGCTTTTTATTGCTCTTTATGTTTGCTCTAATAAAATATTGACATCAAATTGTTATTATCTATTGATGATGCTCTTAAAAAAACAGATACTGAGTATATATTCAACTGGCCTTTAGGTATTAATACAACTATTACTGAATATCTGTAAGATAAATCTTCATTGAATAAGAAGGAGTAACTCAAATAAAAAATTATAGAATATTACTAAGATTTGGAACAACAATTTGTGAAATAATTATCAGAATCTAAATAATAAACTCTCTAAGATCTTGAAAATAATTCTGCCTTAAAAACTGATATCATAAATACTTACAACTTATATTTCTATAGAATTAATTTAATACATTTGTTAAGTAATATGGATGAATAAAAGGAATAAATATTCAAAGAATTAGAAGAAAAGATAAAACAAATAAAATATATTGAATATTAAATAGAAGAGGGTGTTCCATATAAGATTAAATAAAACATAAATTAGCTTATAAAAAAAATTTAATTTTTCGATTGCTCACTCAATAACACAAAAAAAAGTAAAAAAGATAAAAATTCAATATCAGTAATTCTCGATAAGAATATTAACTAAATGGCTCATAATGATATTTTTGATTGTATGTTACACGAGCCTGTTAATAATAGTTTAATATTTTAAAATTTATTATAAAAAAATAAAGAATATTAATAAATTAAAACTTCTATTGAATAAATCATTAAAGACTAGGAAAGATAGTGTCTACGAGTTTAAGAATTTAACCTATTAGATTTCTAATAGTAAAATACAAGATCGAAGATAGTAAAAACTATTCTTCATCAATATTACACTTTGAGCTAATAGCAATAATTTGAAATTCAGTTAAAAATGAATTCATTATCATAGAGAAATGTTTTTATAGAATTTTTAAATCAAAAAAAAACTGAAATACCCTAAATTCCAAGTAAAAGCTAATAAGGAAATATTTTTGAAAATTTAACTTAATAAAAAAATACAAATTTGTTTGAAGTAAAAAATAATGTTCCTATCACTCCTACTCCTACTGAAACTAAATTTGAAAATAAACAAAATATTTAAGATAATCGAACAGAAACATAACTAATCAAAAAAATGTTAATATGTGGAATAATAGAATACTAGGTGGAAAAATAAAGAAAGACTCTTCATATAAGTTTAAATAAGAATAGGGAGGGAGGTTGGGAGGAAGAAAATCAATTTTAAATTAAAATGGATAAAGAGATTGAACAACAAATGTTATTCAAAACATATCTTATTGATTAGAAGAAAAATTAATAAAATCTTAATTAAAAATAAATGGGTGATAACTAGAAGAGACACTTTACCAATAAATATTATGAAAATAAAGAACCTAAGTTCAACTACTTACACAAAAAAGTTAGAGAATACACTGTTGACAACAATGGTAAGGAAGTGCCTGAATAATCTGGATAGAATGAATATAAGGTGACATCCAGATAATCAACAATGATTATTAAGAAAATTGCTTAAGATAGCGAGTAATAAAAAAATCAAAATAACTTCCCCGTCACTTTAAGTGCTATTGGTTATGCTGTTAATCATGCATTTTAAATTTTATAGGCCTACAAATAAACTAACTCTGTTGTTGGTGATGTCAAAATTTAGATGTCAACTCTTATTATGGAGTTTGAAGCAGAACCTCTCGTTGAAGGTTTAGAAAAATTGGATTACAAAACTGTAAACGGTAAGATTACCATTCAATTCACTTTGAATATTTAAAACAATGAAGAAAATGAGAGAAAATTAAACAGTATCCACATCTCTAACAGAGTATCTAGAAATAGAGGATACAACAAGGGCTAAAGAGTATCTAGAAAAAGAAATTATAAAAATAATTAAAAGCCATATAAGCCATAAAGCAAAAAAAGAGGTTTTCGTAGCAATGGCAATGGTAACCAAGAAACAAATCAAGAAAATGGTTATGATTAAAATAAAAATCAACATCAACATCCTCACAATCATTAAAACAAATCAAATTAAGACAATCAGCAATAAAATAAGGGCGAAAGAGGAAATAGAAGAAATGATCGTACTAAAGTCAATTAAGGCAAAAAACCTAATTTTTAACCTAAGTAAAGAGATAACCAAAACAAAAGAAACTAATAATAACTCCTTAGTGATGGAATCAAAGAAGCAGGATGA