TTHERM_00661490

Length: 1095 bp

cDNA Sequence

ATGAGCTGCACGGTTGAGTTGCATTATATCCCTAGAGTTAATGTTAATGAAGAGATTAAAAGTCTCTAAGAATCAGATGTTTAACAACGTATCGAGTAAAATATTTAAATTGATTAAGCTGCGGAAAATGAAAAATAAAAAACCAATGCCTCTGAATAAAACAATGCAGAAATAAGAATTGAAATTGATCCTATTGAGAATCAACAAAACCAAGACTAGGTACTAGAATAGCCATAGCTTAAATAGGAAAAGTGCATTTCCATAGAAACTGAACCTTAGAATGTGGTGACTGAAATGGCTAGCTTACCTTTTTAAAACATAACTAAATAAACACAGAAAGAATTCGAGGATTTAGTTGATTATGATAAAAGCTCAAATGCTAAAAGCAAGTATTTAGTATTTCGTGAAATAAATATAAACACTTAGTAAATTCAAGAAACAAGCTCTAAGATAAAGAAGTCAAGCAACCTTTAAGGTTTGACTTTTTCTAATTTCAGTGATTTTAAACTCGCCCAAAAAAAGGCTATGCTGAAATCTGTTTTAGAAAGCATTGATACTACTTAAGTAGCTTAACCTGAGTAATTAAAGAGGGAGTTTGTTAATTCCGATTACTACAGAGCCATAGAAATTTTTTCAAACAAGTTTTAAAATCTATACAGATGGAATATCTTTTTGCTGATATTCCAAAATCTATTGATTCAAGCTGCATTTGTTATCGGATTTGTTAAATATTATAGCCGCGATAGCAGTAAAGATTAATTAATCGAACTTATTATTATTCTTTGTATTGCATTGAGCGTAGTTACTGAACTATTCTTAATTTACCGCAGTAAATATTTTTTATAGAAGGAGGGAAATGACTATCTATTTATAATAGCTGCACTTGTTTAAGCATTTGCAGGTATAGTAGCAGTATCATTTGAAATGAATGAATCTTCGGCCTAAATAGCAACTTTAGCTTATCTTCTTTATCTCTTATCTTATATGTTCTACATCCTTTTCTTAATTGTCAGAATTCTTCCAAGATTCGAATTTTTGAAAGATACCTTCTTTAATTTCATCTACACAGAACCATAACCTTAAAAAAGAAATTGA