TTHERM_00666640

Length: 891 bp

cDNA Sequence

ATGCTCTTCACTAAAAGTATAGCTAAGTTCTCCTCAGCAGCTAATGTTAAAAACTTCGCAGTCGTTGGTGCTGGTCAAATGGGTACTGGTATTGCAATCGTTGCCAACAAGATTGGTGGTTTGAATGTCAAGATTGTTGACTCCACTGAAAAGGCTCTCTCTGGCAGCAGAAAGTTCACTGAAAGCTGGTGTGACAAGGAAATTGCTAAAAATCGTATGACCAGCGAAGAAAAGCACTAAATGCTCTCTCGTTTCTCTTACTTCACAAAGCTTGAAGATTTAAACGATGCTGACTTTGTTGTCGAAGCTGTCACAGAAAAGTTTGAAGTCAAGAAAAATATCTTCACCACTTTGGATCAAATTACCAAGCCTGATACTATTTTGGCTTCCAACACCTCCTCCATTTCTTTGACCAAAATTGCTGCAACCACCAAGCGTCCTGAAAAGGTTATTGGTATGCACTTCATGAACCCCGTCCCAGTCATGAAGCTCATTGAAATCATTAAAGGTCTTCAAACTTCCGATGAAACTCTTTAAACCACCTTAGACTTATCTCATAAATTGGGTAAGACCACTGTTTTGGCTAATGATATTCCGGGTTTCATCCTTAACAGAACTTTAATGCCATACATCAACGAAGCTGTTTATGCTTTGTTTGAAGGTGTAGCTACTGTTGCTGATATTGATTAGGCCATGAAGCTTGGTACTAACGTTCCTATGGGTCCCCTCACTTTGGCTGATTTCATCGGTTTGGACACCTGTTTATTGATCATGTAAGTCTTACATACTGAATTGGGTGATTCTAAGTACAGACCTTGCCCCTTGCTCGTTAACTACGTTAATGCTGGCTACTTAGGAAAGAAGAGTGGTAGAGGTTTCTACAAATACTGA