TTHERM_00666680

Length: 2232 bp

cDNA Sequence

ATGGACGTAGAAAACAGTCAATACTTTTTGAGTTAATAATTTGCAGTTCACACTTAAGGTGCTCGTTGCGTTGATGTGAATAATAATGTGTTAATTAGCGGTTCAACAGATAAAACTGTCAAAATTTATTCTTTTATAGATAATAAATATGAAATGATATCCGATGTTAATTTCTTTGATGACTATGTCTACTCTGTCAAGGTTAATCTCAAAGGAGATGGATTTTTCGTAGGTTCTAAAGATACTCACATTTACGTTTTAGATATAACTGGCAGTCCTTCTACAACTTTATCTGGCCATACAGGACCAGTTTGTAGTTTTTCCCAAATAGACAACGATACTTTAGTTAGCGGAAGTTGGGATGGAACTGCAAGAATTTGGGATCTTAGAGAAGGCAAAGAAGTTAGAAAGTTTGAAGGTCACTCCCATGCAGTTACTGTATTGGGTGTTATGCATTTAGACTTATTAGTTACAGGTTCTTAAGATAAGAATCTTAACTTTTTCAGAATCAGCACAGGTGAAAAGATTAGAACAGTTAAAGAAGCTCATACTGATATTATTAGACAAATAGCTTTTATTGAAGATGTTGGTTTTTTGAGTGCTTCAAATGATGAATTATTAAAATTATGGACATTTGATGGTGATTTGATGTAATAATTAACTGGACACACTGCTTTCGTATTTACATGCGCTTGTTTAAGTTTTGGAAAATATGTTTCTGGAAGTGATGACTAATCTATCAAAATATGGAATGATTCAACTAACATCCAATCTATTTTGCATCCAGGTACTGTTTGGAGTGTAACAGTTAATAATAGAAACCATGACATTATCACTGCTTGCTCTGATGGTTCAGTTAGAGTTTTTACAACTGATCCTTCAAGAAAAGCACCAGCTATAGAAATTGAAGATTTTGAGAAAAATGCTACTGTTTCTAATGCCAAAGGTCCCTAAGGACTTCCTCCCGATGAGTTAGCAAAGCTTCCTGATGTAAGCTAATTAAATTAATTCCAAGGAAAGAAAGAAGGCGAGCTTAAAATTTTCAAAAACGGAGGAGTTCCTGAAGCATATTCATGGAAATAAGCAGAATAAAGATGGGAAAAAATTGGTGAAGTTTTGTCAACTATTCCTAAAAAAACTTATCACGGAGATGAATTTTTCGCCGCAGGAGATTATGATTATATTTTTGATGTAGAAGATGATAGCGGATTCACAAAGAGCATTCCTTTTAATGAAGGTGATAATCCTATGGAAGCAGCAGAAAAATATTGTGCAAGAGAAGGAATAAGTAGAGCAAATATTGAGCAAATTAGATAATTCTTAATGAAAAATACTAAATATCATTAAAATTAGGGCAATTAAAAAAAACCATAGTAAAATATTTATGCATAGCAATAGGTTTAGTAATAGAATAAGTCTAGCATTTACTTCCCTCTCAATCAATTTTAATATTATGAATAAAAGAATTTGGAGGGATTAAAAAAGAAGGTGCTTGAATTTAACGAAGCATTAAAGGCTGAAAACCATCCTCTTCACTTGGTGGAAAAGCAAGTAATTTATTTCAACACAATGATTGACATGCTTGAAAAGACAAATATGTATCATACTTCTCGTCTCAACTACAATGAAATGGAAGTATTTACAGTCAAGCTGATTAACTGGCCAAAGTAATATATGCTTCCTATATTTGACTTATTCCGTATATTCGCTCTTCACCCTTAATCTGATGCTCTCTTTAGTGGTGTAGACTCTGGGCTTCATTATTTTACAGTTATTTGCGGAGGTTTGATGTCTGAAGAAAATAACGATGTCACCAAAAATGTTATCTTAAAGATTCTTGTCAACTTATTTAACCAAACTTCAGGACGTTATGGAATCTACAAGCACCATAAGTTTATAATTGAGTGTATTCAGAGATTAAGAGATAACTAGAATGCTAATTTGCAAACTACATTAGCTACTCTTATGTTTAACATCTCTGCTGAATACATCAACAACTAGAATCACTCTGTTGACGCTGTTACTGCTTATGTTAATGAAATAATTTTCTTGATCTAAAAAGAAAAAAATGCTGAAAATCTATTAAAGTATTTAATTGCTTGTGGTAATTTTGCTTTAAAATCTGCCAACACAGCTAAACCACTTATTAAAATTGGTTTATCTTTTTACTAACCTTAGATCAATGATGCTAAAATAAATGAATGCTTAAACGATTTAAAGAGCATTCTATGA