TTHERM_00671990

Length: 801 bp

cDNA Sequence

ATGGCTACTAAGAATTATTGCAACATTTTAACACCCTCTCCCTCTCTGCCTTAAGGTAAAATAAACTGCTTCAATATGATTTATTTTGTCACATTCATTTGCTTATTAAATTAGAAAAATAAAGAAGCTTAATAAAATAAATCATAAACATCTAGCACTATTTAGCCTTAAAACCAAAATTTTCCTCCAAATTCATTCTAAAGTCCTCAATCTACAGCTTAAAAAGCGGCAAATCCTTATAAATAAAAAAATTCATTGAATCCGAAAGATTCAAACATCCCTGAATAAAAAGAATTATTTCCTTTCCTCTAAAAAGCAAGAGAAAAAGACCCAAGATAATTAGGTGTAAATATTTAAAAGTGCTAAGAAGTTTATGATTTTTATAAGAGATTAAAAGATTGCGAAATGCCAGTAAAAGAGTTAGGAAATGCATTAAGATCTTTAGGGTACCTTGTGAATACAATAGAAATAGGAGAGCTTCAATAAAAACTGCAAAAATAAAAAATGTAAATTAACTAAATGGCTTCAGTGATCGAATTCAAAGACTTTTTGGTAGCTGTAAGTTTGGTTTAGCATAAATTACCTAACGAAAGGGAGCTATAAGAAGCTTTAAAATTATTTGTTAAGCATAAAGAATATGATGTTAATAGAGAGACCCTCAAAGGAGTAATCACTAAAATAGGAGATATAATTCCAGAAAAAGAATTTGATACACTCTTTCCAAGCATCATGACAGACCAAAAAGGAAATATTCCAATATAAAAAATCACATCAATTCTTCTTAGACAACCTTAAATTTGA