TTHERM_00675720

Length: 2937 bp

cDNA Sequence

ATGAAAATTAAAGCTAATTTGTTTTTATTTAAAGTAGATTAAATGATGCTGCTTAACGCCTCTAAAAATAATAGCTAGAAGATAATCAGGGCAATTAAGAATCAATTAAATGTTTTGCAAATTTAACCAAATTAAAACTTAAAATATAATTTTTGCTCTAAAAATAATTAAAATGCTACTGATAAATAAAATATTTAAGTCAAATTGCAGGAAGTTTAAAAGATTGATTAATAAATGCACTAAAAGTTAATGGAGTTAGAGAAAAAAATTATAGCAAATTAATTTGATGAAAAAAAGTTTGTGATATAATTTTAATCATTGTTCAATAATTATAACTTAAACAAAGAGGAATAAGCTACCAAGCTTATTAACTAGCTTAAAATTTCTATTGATCATGTACAGAAGCTATAGACTATTGTAGGAGTTATTGATAAGGCAGCAAAATACAATATCTTTTTATCAAAGGAGTTTGAAATAAAGCTCTTAAACCGTGGCTTATATCTTATAAAGAACGAAAAATATTACAATATTAAAAGCGATGAAGGTGATTTAATTAGGGCTTTAACACTTGTTGCTGGATTAAAGAAAATAAGACACCTCAGCTTTTATGAAAGTATAATTGATATTATTAAAAATGAAGAAATATCAAAGAAAAATTTACTTACAATTATTGAGACTCTCACTTACAATAAATTGCTCCCTCAATTAAAAAACGGTAACGATATAACTGACTGCCTTGCAAAGTTATCTCGACTAACTCCTAACGATTTAGAAATATTTTCTCCTGTTTCTAATTTAATTTGCTATTATTTGAAGAACAAACAAACTATATCTTTATTCAACTAAAATACCAAGTTCTCAACTGTAAGCGAAGAAATCTTTAAAAGCATTCATAATTGTTTGTTTACTTTGCTTTCTTAATAAACTCCCGATAAACTAGATGTTTTCTTAATAGCAGAAATTTAAAATCACTTAGAAATGTTTGCCAAATTATCACAAAAGGAAGAAGCTCTATTTATCTAAAGAAAGTTTAACAATTTATTCAATCAGTATATGACAAGAAACTTTGCTTAAAAGCAATACTACGATTACGAAAAGGTTTTAAGATATGTAAAGAAATTCATAGCAGCTCCTCCAATTGTTTTAAATCCCATAATCGTTAAACTAATTGGATAAACATATCAAACTGTCAACCCCAATAACATTTCTGAAATTGTACCCTTCCTTTATTTCCTCTCAAAGACTGTCCAAAATTTCAAAGTACCTTACGAAAGTTAATAGGTGATTGAAAAGAATTTGCAATAAGAGAAAAATATAATTATGCTTAGTAAGTTGATGGAGATTTATGCTACTACTCATTATTCAAATGATTAAAATATTTAAGATTTAGAGTAGAGAATCATTTAGCTTAGTAGTTACAGTGCTAACCCTACTTCTCCTTTGCTGATTTTGTTTTAATCATTAGCAAACATGCATAGAGGTTAGACTCAATCTCTTCGTTATATTGTTGACTACTTTAAATATCCTGGAGTGCTCGATAAAATTGAATTCTTTGATTTGATTGTTAAGTTTATTCCTTCTTTAGCTATTAAAACAAAAGAGCTTTACAAATTTGCAACTAATATGGGATTTTAATCTTAAACCAACTTAATAGATGACACAAACAGAATAGATTTAGATTTCTAAAACAGTTTGGAATAATTATGGGATAAGGTTGAATCTTTAGTCATTTCAAGGATAGATGAAATTTATTACGATAAATACCCTACTCTTTTATTACATTTTATGTATGCAAACTTAATGAAGAACAAGTATAAGCGCATATTTTTCATTCTACAATAAAGAGTTACTCAGTATTTAGACAAGTATACTCCTAAATAAGTTAGTGAGATAATTTATTCCTATGCAAGAATGCATGAAAAAAACAATGAGTTATTCTTTAAATCAATACCAATTATTTTAAAGAACATAGATTAATTCAACACTATCGAATTAATCAATATTTATTGGGGATATGCTAATGTGCGTATATATGATAACTAGCTTTGCACTGCATTAGAAGAAAGCATTATGAAAGAATAAACTAAGGTTAATCCTGAAGGATATATTCAATTTTTCCATGCCATAGGTATTTTCAGTAGACAAATAAATTCTGGTTCTAAGTTAGACGAGTTTATTCGCTCTAAGATATACAATCTAGATTAGTTGAAGATAAACGTTCAACAACAATTTGCTTTGGCCTATGCTATTTTGCTCTTCAACAACAGAAGCTAATATTCTCTCTTTTGGGAAAATATAATCAACCTAATCTTGTAAAACCAATCCAATTTCATATCAAGTCCTCTATACATGAATTATTTGTATCAAATCTACATACATCTTAGATACTCTGACTCAATATTCTTACCCTGTATGTAGATTCTTCTCTAAGTGTTAATTAAAAATAGAGATTCACTTATCCGTTTTTACAAAGTCAATAAAAGATACACTAGCTCCGATCTTGAGAAAAAAATTACCTAAGTAATTGATGAAAAAATAGCTGCTCCTTAAAATGACCAAAAAGTCTTTGTAGTCTAAATCAAAAATGATATTCCATTAATTTTCTATGATGACTTAAGAGAGCTGGAGTAAAATCCTAAATTCCCTGAACATGAATTGATAATACCTTATACTCTGGATTGTAGAAAGGGTGCTTTATGTTTCGAAGTAAATGGACCATAACATTATTTGAGTGATATATAAAATTAATCTAGTCTTGATGGCGTTACATTGCTTAAGAAAAATTTCCTTGAGTAACTCGGCTTTAAGTATATTGAAATAAAATACACAGAATTTGTTCCTGGTATAGTAAAAGAAGACAGCTTGCTTACTTAAAAAGTAATGGATATTGTAAAAGAATAAATGAAAGACGTTAACACAAAAAAAGTTTAGTAATGA