TTHERM_00678180

Length: 1134 bp

cDNA Sequence

ATGATGGCAGGCATTTGCTCTGGCTTAAATGTTGGTCTTCTCTCGATTGATGTCGTAGCATTAAATCTTAAGATAAAGAGTGGAACAGAAAACGAAAAGAAGAATGCATAATAAATTTTAGATGTTCTTTCAAATCATCACTTGCTATTATCGACTCTCTTAGTTGCAAATGCATTAGCTATGGAAGCTCTTCCTATATTCTTTCATGAAATAATCCCTGCAGCATTTGCTGTTTTATTTTCAACTATTATAGTAGTCGTATTTGGTGAAATTATTCCATAAGCATATTGCACAGGTCCTAAATAATTCGAAATAGCCTCAAAAAGCTTGCCTATTATAAAATTGTTGATACTCATTTTTTGGATTTTCTGTTTCCCAATAGCAAAATTCTTAGACTGGTTATTAGGCAAGCATGACAGTAGTAAATATAGAAAGAACAAAAAAGATTTAAAGGCATTAATTGAACTCCATGAAAACGGATAGCATGACACTCATTTATAGCAATTTGGATTCAATAAACAAGAAGTAATGATGATTTCATCAACCCTCGATTTAAGAGAACAAAAGGTTACTGAAAAGATGATTAAGTTAGATGATTGCTTTATGCTTAATACAGAAGACATTTTTTCGAAAGAACTCATTTTAAAGATAAAATAAAGCGGTTTCTCTACAATTCCTATTTATGACAAGGTTAGAACTAATATTATTGGATGCTTAAGAACAAAAATTATATTAGGATGCGAAAACAAGCATTTAAATAAGCCTATAGCCACAAGATTCCCTCTAACTTAGTTATTGATGATAGCAAAAGACACAAACATGCTTTAGATGATATAAATCTTTTAAAAAAAGAAATGTAGTCTAGCAATAGTTACAACAGAAGAAAAAAAGAAGAAAAACAATGAAGAATTGTTAATGAGTTGCAGAGATATGATTGTTGAGCATTATAGTCAAATTGAAGGTATTATCTTTTTGAAAGATGTATTTGAAGAAATAGTAGATATAGACTTCTAAGATGATGATTTGCATATTAAGCATGATGAAAAAACTAAAAAAAAGACCAAGAGCACTATGAAAATAAATAACTCCCTACAAGAACCTCTTATAAGCCAAGGATCAAATAAAAAAAACTGA