TTHERM_00684450

Length: 1659 bp

cDNA Sequence

ATGGCTGGGATCGATCAATTAATCAACTAAGAGATATCAGACTTTACTTTAGATTCTGTTTATAATAGTAAAAAAATGTTTATGAGCAATTTGGGCTTGAAAGTGCCTGATTTCATTGAAAGTACTAGATTAAAATTATAAGTTAAGATTAATGATGAGTATAAATTTGCTTATGATAAGTAGATAAAAGAGGCTTAAAAATAAGAGGAGCAAGATATCCTCAAGCTTGCAGAATAATTTTATGATTAATCAACAGAAAGTAATGTCCTTCTTAACGAGCAAGTCCAAAAAATGCAAGAAGAAAAGAAAATCAAGGAATTAAATGCTTAGAAAAGAAGCAATATCGAAGTAGTAATTGAATAAATACCTGAAAAGCAAATTGAAATTAATAAAAAGTTATCAAAACTCCCAGCTTCTTTCCTAAAATATGGATAAAAGGCTGGATTAGATAGTCAAACTTTAGAAAAGAAAAAGGAAGAAGAAAGACTTATGCTTACTTATTCAGGATCAGCATCTACTGCTAATAATTAATTATTATCATAAAGTGAGAGAGATGCTTCTAAATATCAAATAGCTAATCTATCTACTGATAACTATGTTAAAGGAGGTGAAGTTATTGATACTGTTAGAATGGGATCTGCTATCGCAAGAAATATTACAAAGGTTATTAAGCCTGAGTGGCATAAACCTTGGAAATTAATGAGAGTTATTGCTGGCCACAGAGGTTGGGTTAGGTGCGTAACTATAGATCCTGCAAATTAATTCTTTGTTACAGGATCAAACGATAGAACAATTAAATTCTGGGATTTAGCCTCAGGATAATTGAAATTAACCCTAACTGGCCACACATCTCCCGTTAGAGCTTTAGTAGTATCTGACAGACATCCTTACTTGTTCTCTGCAGCCGAAGATAAAACTGTTCGTTGCTGGGATCTTGAAATGAATTAAGTCATCAGAAACTATCACGGACATTTATCAAGTGTTCATTCTATTTGCATTCACCCTACTTTAAACTTAATTGCAACTGGTGGCAGAGATTGTACAATTAGATTATGGGATATAAGAGCAAGATCGTAGGTACATGTTTTAACTGGACATTAGCATGCTGTAGGAACTGTTATAAGTTAAGAATTTGAACCTTAAATAGTATCAGGCTCTTATGATAATTATATTAAAACTTGGGATATTGCAGCAGGAAAATGTATGAAAACATTGACAAACCATAAGAAACCTGTAAAGTCTTTAGTTTTTCACCATAAAGAATACACATTTGCTTCAGGTGCAGCTGATAATATCAAGGTTTGGAAGTGTCCCGAAGGAGAATTTTTAAGAAATATATCATCTGGAAATGATCATATAGTAAATTCAATTGCTTTAAATTAGGATAATGTACTCGTTAGCGGTTGTGATGATGGTACTCTCAAATTTTGGGACTGGAAATCAGGATATAATTTCTAAACAATTAAATAAAAGCCATAACCTGGTTCTATAGCTGCAGAAAATGCTATTTTTGATATGAAATTTGATAGATCATAAATGAGACTAATCACTGCTGAGTGTGATAAAACTATAAAAGTTTATAAGGAAGATGATGAAGCTACAATGGAATCTCATCCAATAAATGATTTTAAAGTAGAATATGGAAAGCAAGTTTATTGA