TTHERM_00684590

Length: 1386 bp

cDNA Sequence

ATGGATTTCGCTAAATACTTTTTTAACACCTCAAACACTTCCTTTTTTAAATCCAGCAACAGCAATGAGGCAAATAATTCTAAAATATAATAAAACATTTCGAATAAAAATAGTGATTCTGAGCTATCTGTTTAGTCTAAATAGATTAAATCTAATTCAAAAGATTTATAGCAATCTACAGGCAAGTTTAATGAAACTGCATTTTTTAATAATTAATCAACGAATTCAAGTTAAAATATTTTCTCAAGTTAATACAAAGCAAATATAAACAAGTAAGGATAGTAAAATGCGTTAAATAATATGTAAGTTGGTCCGTTTTAAATAGGAAATAACACCAATGGTTCTATTTAGAAGGCAAACCAATAATAGGAACTAATATTTGATATAAAAGAAAATAAAACATTTTTCCCGTTTTTGAGCTGCTTAAAATAAAAGAAAGAAATTTCTGACAAAGAAAACGATGACCCTAATAATAATGAAAATAAAAATAAATCTCCTTTAATAAACTAACAAGCCTAATAAAATATAAAAAAATCTCCCCCTTATCATAATATTTATAAAGGAACTTAAGATCGTATATTTAATCCTTATGAATGGAGTATACAAGATTTTGAAATAGGGCGTCCTTTAGGATCTGGTAAATTTGGACATGTCTACTTAGCTCGTGAACGTAAAACTAAATTTATAGTTGCGATAAAAGTTTTAAGCAAAAAGTAGTTAATCGATAATAATGCAGAAATATAATTTAGAAGAGAAATTGAAATACAATCTCATTTAAAGCATGAAAACATCTTATAAATGTATGGATTCTTTTGGGATGATAAAAAAATATACCTAATATTAGAATATGCTTCTGGAGGAGAGTTATACAAAGAATTAAAATCTCAACCTCTCAGAAGATTTGATGAAGTTACAGCTGCAAAATATATAAAATAGGTAGCATCTGCTCTAAAGTATTTACACAGTAAGCATGTAATTCATAGAGACATAAAACCAGAAAATTTGCTTAACTGTGATGGAACAATAAAAATTTCAGATTTTGGATGGTCAGCACATGCTCCAAGCAATAAGAGAAATACTCTATGTGGAACTTTAGATTATCTGCCTCCTGAAATGGTTGAACATTAGAGCCATGGTAGTCATGCTGATTTATGGTGCTTAGGTATATTAACATATGAATTTTGTGTTGGTTCTCCTCCCTTTGAAGATAGATAAAATAAAAAAACATATGAAAAAATAAAATAAGTTGATATTAAATATCCAGATTATTTATCATCAGACGTAGTCGATTTCATTTCTCGTCTTTTAACAAAATAACCTTCAAAAAGAATGAATTTAGAATAAGCTCTTAACCATAAATGGGTTAAAATGTATAATGAAAATTGA