TTHERM_00688340

Length: 990 bp

cDNA Sequence

ATGTAGGAAACTAAATATTTTAATTTCATAAAAGAAACAATTAAATTTTATGAATTTTAATTAGATTTGCGCTATCTAAAAAATATCATAAAAATTTAAACGAACGAAAGATAGCAATAAAATAAATAAAATACCAAGATATGTCATTCAGAGGTTAGATATTTTTTTTATCCAAAAGAATATTTTAGCTTTGAGCTTACAAATTTATAAAAACCTTTATCTTAAAATATTTTAACCATTAAATTAACAGTCTCTTCTCCCCACAACGAAAGAATAGCTAAAATTAGCGAAAAATTGAGCCAAGTACAATCCAATGCTAATAATGATCGTTCTGCAAAATTAGATTAAGGCGAATAAAGAATTAAATTGTTAGAAGATTCATACACTGAATTCGAAGAAAAGCTTGAAAAAAAAGTCACAACTATTAGAGAAACTATTTAAAAACTCTCCAAGCTTGTTTAAGAAGATAAGTTGAACAGAGAACATCATTTCGAGCAAAAACAAAAAGAAATTGCTTCTCTTGATCAAAAGCTTAGCTCTGCCATCGAAAGTGAAATTGCATCAAGAAAAGAAGGTGAAAATAAAATTACTAGAGCCATAGATGAAAAGACAAGTGTTATTAGAGATGAAATTTCAAGAGAATCTAAAATCAGAAATGAAACTATTGAAGAAATCAACCGCAAGTTAGAAATTGAATTGCCCAAGCTCAGAGATGAAGTTAATAACGAAAAAGTTCAAAGAGAGGAAATGGATTAAAATATTATGAAGAAGACCACTGAAGAACTTGTAAAACTCACTAACATAATATAGTAAGAAAAGAAGGATAGAGAAGAAAGCGAGTAATCTATATTTGATATGTTGAAAGAAGTAGTACACCGTGTAAAGACTGAAATCGAAAATGAAAAGAAGAATAGAGAAATGACAGAAGAAACTCTTCTTGGTTTATTAGAAGACACTTGCAACAAATTAAATGCTGCTGCCCTTGTTTGA