TTHERM_00688480

Length: 843 bp

cDNA Sequence

ATGGAGATGCTGTTAGATTCTTTATATAACAAATTTGGATAAAATGCTTAATTTTTAGAAAATTGTTGGGGAAGTTTAGAGTATTTCGCAGAATTACCTACCACGAATATTGAAGATTCAAAGAAGAGAATAGATTTATCGTAATACGAATCTAAAGTTCTCTCTATAAAAATACTTGACACTCAATGTGCTTATATATTCAAAAAATGGACCTTAGAATATGCTTTATTAATATTTGAAACAATTATTGTATTCAATTTTAATTAATAAAATAATTAATATGCATTTTTTTATATATAATAAAAGAAAGATGCCATCTTCTTAAATAGAAATGATCCTCTTATTCTTTTTATGCATTTGATATAAAACTCAGAAGATTAAGAAATATTATAAAATACTTGCTTAGCACTTGAATAAATTAAGATATTTATGGAGAAAAGCTCTAAGTATTGTAAAATACCTGAGGTTAAGAGGATTGATGTTGAAATAGAAGTAAGGAAAGATGTCAAAGAATTTTTAGATTAAAAAAAATATACTAGGAATAGCTCAAAAAAATAAACTGGTATGCCACTCGTGCTTTTAGAAAAATCTGGAGTGAATAAATTTCTTAACTAAGATAGCGATGACGAAGCAGGAGATGGAAAACTTTAGAGATCTTCAAGCATATCAGATTTAGTTAGTTAATTTCCAAGATAACTTGAGTATTGGCTATATGAAGGAAATTCAGATAAATTGATGATATAAAAGAATGATTTTATCATGGAATCACTAAGAATAGCCAAAACAATACCAAGTTTCAAGAAAATGGGCTAAAAGTATTGCTAATCTGCATTATCATATTGA