TTHERM_00688560

Length: 759 bp

cDNA Sequence

ATGCAAAAAAGCGGTATCTACTCAAGTCCCTACGCTGAACGTTTCAATAAAATCAGTGAAAAGCTTTCCTAAATTCCTCTTTCTTAAGAAGGATCTAGAGCAAACAGAATCGATAATTTTGAATAGCGTGTCCGTTAACTTGATGAAAAGTTTAATACATCAATTGAATAATACAATAAGAAAATTGCTGGATTAAAAGAAGAAGTATTCAAGCTTTAAAAGTTGGTTGAAGATAACTCAAAGAGTTTCGAATTATAGCTTGAAACTCGTAATAAGGAAATTACCAACTTAGACAACAAACTTGCATAAAAATTAGAAAACGAAATAGCTAGCCGTCGTGATTCCGAATCAAAGTAAGTGAGATACTTAGAAGAAAAGATCAACTTCCTCCGCGCTGATATTTCAACTGAAACTAAGATTCGTTCAGAAATACTTAGCTCTCTTAATGCAACCTTAGAAGCTGATCTTCCCAAGCTATATGAAATAGTTAAATCTGAAGGAGTTGAAAGAGAAAGCTGTGACTCTATTACTCTTAAGAAGGCTGCTGATGAAATTAAGAAAATCCATGACTTCCTCGCTACCTAAAAGAGAACTCGTGAAGAAACTGAGTCAACCATTTTCGAAATGCTTAAGGAACTCGTAAATAGAATCAAATCAGAGATTGATGAGGAAAGAAAGGATCGTGAACAATCTCAAGAAACTTTAGTTAGTCTCCTTGAAGATGCTGCTAATAAGCTATGTGCAACTGCTCAAGTTTGA