TTHERM_00688790

Length: 1506 bp

cDNA Sequence

ATGGCTTCAAAATATTGCGTTTTATATTCTTTGATACTAATTTTGCTTATCTGCTAAGTTAGTTCTTTAAAATATGAAACTATAACTAAATTATAAGATGTTTTAGGAAGTGGAGATTCCTATCCTTCTTAGCTACCAGTTGCCTCGTCAAAAAGAGCCTTAGAAAATGTGAAAGTCCTTTTTGCTTTCTCTCATGGCGTTGAAGATTAAGAAGTTTACTACTTTTATAACTATTTGATTGATAGAGGAACTAAATAAATTACTCTAGGAATTGACTATAACGGTTTGGAATCAGATGTTATTCTTAGTGATTTCTACAAGCCTTCATACAGAATTCCTAAATAGTTTACTATGGATATTAACAAAGTAAATTTTAATGATTACGATGTCATATACATTCCAGGTGGTTTACCTAGTTCATCAGCTTTGAGAAATAATCAATTATTTATACAAAACCTTAAATCTTTCTATGAAAATAAGCAAAACTAAGAAAAACTGGTAATATTTATGTGCTCAGGAACAGAAGTTTTTATTTAGTCAGGAATCATAAGTGATTATCATGGCTTAAACTTAACAGGCAGTCCTGCTTCAGTTCATACATTCTCAACATACTTAAAAGCCCATAATATTCCTTTAAATACTTTTACTTCAATTCCAGCTATCAATCTTAAGACTTATAATAAACCTAGAGTAATTCTAGCTCGTGATCCAAACGCTTCAACCTAATTTGTAACTATGGTGTCTAATGAACATTTTCACTTGAATGAGAAATTACCATCCGCAAACGATTTTACTCCACTTAGAACAAAAGATGGTTACCCAGCAGGAAAATTTTATCTTAAAGGGTTATTTGAAATGATTCCAGAAAATACTATCCTATCCTCGCTTCCTATTGCAAATTCGATTAAACACTTAATGAGTTAAAATCGTTTCTTAAGATCTGAATATTAAGAGATGTTAGCTGATAGCCAAAAGATCTCATTGATTGCTATGTCAAGTGGTGTAGTTTAAAGAGAAATTGATTAACTATTTGAAAAGTTAAAATTTTCTCCAAACTTAAGTTATACAATTTGTCCAGGTTGGGTAAAGTAGTATAAAAACTCCTAAATATTTACTTTTAGCTACCCACCAACACAACCTTTAAAGAAAATTATTTGTGATTATTCTTATGAAGAAATTTTAGAGAAAAAAATTCCTTTCGATAATATCATCATTCCAGGTGGTCTTTTCTCTACAAACGCTGTTCTTAGAAATGATGATGGATTTTTAGATTTCTTGAATTAAGCCATTAAACAGAAATCAAAGCAAATACTATTTTCCTCCTCTGGCTTAGATCTCTTACTTCCTTTGAAACTTAAATATCCAGATAATTAATTGATTTAAAGAATTAATGAAGTTCCTGAAGACAGAGATGTAGGAGTTGATACCAAACTAGCTGGGTTAAATAATAGGAGGGATAAAAAAATAATTTCTTTAGAGTAAATTACTTTATCCACTTTTAATTGA