TTHERM_00689850

Length: 513 bp

cDNA Sequence

ATGAATCAAAGAAAGAATTAAACCTAACAAAAGAAATTTAATCCTGCAGATTATGTTAGACCAGGTGTTACTGAAGACGAAGTCATCGAAATTAAGGAAGCCTTTGATCTTTTCGATATGGATCTTGGTGGCACAATTGATCCTTCTGAACTTCAAGCTGCTATGAGATCATTGGGTTTCGAAGCAAAAAATTAAACAATTTATAAAATGATTGCAGATCTTGATACTGATCAAAGTGGTTAAATCAATTTCGCTGAATTCTTAAATTTGATGACCGCTCGTATCTCTGATAAGGACTCAAGAGAAGATATCAGAAAAGTTTTCATGCTTTTCAATGACGAAAACAATGTTGGTATCTCAATTAAGTAACTTCGTAGAATTGCCCAAGAATTAGGTGAATAAATGGATGATTCTGAATTATAAGAAATGATTGAAAGAGCTGATTCAAATGGTGATGGATTGGTAACAGAAGATGATTTCTACAATATTATGACAAAGAAAAATTTTGTTTGA