TTHERM_00691200

Length: 1071 bp

cDNA Sequence

AAACACAAATCTTAATATAAAGGTAAAAAATATAAATTTCATAGCAATTTTACTAAATATTAAAAAAGAAAGGCAGGAAAATTTAAGAATAGATTTGAAAATAAAATGGATCAACTATACACAGAAGATGAATTGACTGAATTCAAAAACGATTTGAGAAAGTTTAAGGAAATTGGAAATACTAAAGTTTTGGCCATCGTAAAAAGACTTTTTAATTGCCAAATCACAGTATAATAATTATAAAACACTAAAATTGCTTAAACTGTGTAATCTCTCTCTACTATGTCTTGCTTCGATGAAGATGAAGAAGGACAAGAAGCTAAATAAATATGCTCTTAAATTATTAACAAATGGAAAAAAATAGTTTAAAATGAAAAAAATAAGCAAAATCCTCAAGCCTCAAGCTAAAAAGCACCACAATTAACTAAATCAAATTCACAAACTGCTACTTTGCCTAGAAGATAATCCTCTGGTTAAGGTTCTACTGAAACATTTTTAACTAATGAGGAACCCTAATACAAGACAGAATCAAAAACTGATCTTCCTACTTATAAAAGTGATATTCGCTAAAAAGGATTAGAAGCTATTAACAAAATTTTTATGAAGGTTAAAGATGATATTAATGCTTCTCCTAGAGAATGGATTGAATTAATTGTAAATCTTGAAAAGAAAATTTTCTCAAGAAATTCCTAAGTAGTTTACTATAAATCTTATATTAAAGAAGTCCTTGGTATGTTCTCTTCTAATGAAGTTACCACTGAGGTTATTTCTAAAATGTTAAATAAAGAAATTTCACTTTAGGATGTTGCTGAAGCAAAAACTAGTGTCTTCTTGACTGATAGATAAAGAGCCTAGCAAAAAAAAGCTGTTGAAGATTAGCTTGCTACAAGTGATCCAGATTTTTATAACAATATGCGTAGATAGCGTTTACAAGGTCTAGAAGGTGAATTATGTAAAGGATGTAAGAAAAAAACAGCTTTCTTAGTAAAAGAATTATAGACTCGTTCATCAGATGAACCTATGACTCGTTTTATGGAATGCAATAGCTGTGGTAAAAGTTGGAAAGACTGA