TTHERM_00691930

Length: 936 bp

cDNA Sequence

ATGCTCGATTTTGATTAAAAATAACTTAATTAGCCAAAAAATACCATTCCGTAACTAAAAAATAGTCTGAATGAAGCATAAATACTTAAATTTAAAGAATTAAAACAGAAAATTATTGATGAAGCTCATACTTTGTTATGCCCAAAAGATGTAACCAAATTCGAAAGATATACAGAAGACAATTAAGCTGTAAGACTTTTATGGGCTCAAGATTTCCACGTCGAAAAGGCTTTTGCTATGTGGTAAAAGTGGATTTCTTGGAGATTAAAGATTGGTGCAGATGATATAAAAGAAGAGGATATTGCATAAGAATACTAAAGAGGAAGAGCTTTTTGGCATGGTAAAGATAAGTAAAATAACCCCTGTTTAGTTGTTAAAGTGAAAAATCACATTCCTGGAGTATCATCAGACATAATGGTAAAATATGTTTTGTTCTTAATTGAAGAGGCAATCTAGAAATCTGAAGAAGCTGGTACTGGAATGATATCAATCATATGGGATAGAGAAGGATTTAGTATAAAAAATGTAGATTATAAGCTCTTTGAAACATTCAAGTCGCTGAATTAAATTATTTAAGATAACTATGCAGAGAGAATTTAAAAAGTTTATATTCTCTACCCAAATTGGTTCTTCAAAACTATTTATGCTCTTGTTAAGCCTTTTCTGACCGAAAGAACCAAATAAAAAGTACTTTTTGTTGACTAAATTGAAGATATGACCACTTATTTCGAACCTAGTGAACTATTGATTGAACACGGAGGAACTTCGCCTTACAAATTTAATTACTAATTTGAAAAAGTAAATAAATGCATATAAGATAATGAACTATAAAGCAACGAAGTTGATTATAATCTACTATCAAATAATTTTAATTGTATTGATGTTTAATCTGATTAAGAAACTAGAACGGCCTTGGAAACTGAGTGCAAAGTATGA