TTHERM_00693060

Length: 867 bp

cDNA Sequence

ATGCTAAATAAGTCATCAAGCTTGATTAAAAAATGTTTTGGAGTTGTTAATAAGAATGACAACTTCAAATATGAAGTTTTAAACGATAAGAAAATAGGTATCTTAACATTATGCAATCCCAAGAAAAGAAATTCTTTGAGTATTTAAATGGTTAAAGATTTGTCTGAATAATTTAAGGATATAGCTGCTTAAGACTATGCTAGTCAAAATTATGCAAAAGTTATCATTTTAAAGTCAGAAGGAACTGTATTTAGTGCAGGTCATGATTTAAAAGAAATCAAAGAATTATAAGATAAAAATGCACACGAAGAATAAAAATAGTTATTTTAGAGATGTGCTAATATGATGGCATATATCTAATAAAGTTTGCCTTAAATTACAATCGCTTAAGTACACAATTTCGCAACAGCAGCCGGGTGTTAGCTAGCATGTTCTTGTGATTTAATTGTAGCCTCAAAAAGTGCTTCATTTAGTTGCCCAGGAGTTAAAATTGGGCTCTTCTGTTCTACGCCAGGAGTTGCTCTAATAAGATCAATGGCTAATTAAAAAAAAGCTTTTGAAATGCTTGTTACAGGTGATCCTATAAGTGCACAAGAAGCTTATCAACATGGTATGATTAATTAATATGTTGAAAATAATGAGGACTTAGAAAAGGAAACTTTTAAGCTTGCAGAAAAAATAGCTTCTCATAGTGGAGAAACATTAGGATTTGGAAAGCAAGCTTTCTACAAATAAAAAAACATGAATGATTTAGGATAGGTTTATGATTTTGCAAGTTCTGTTATGGCCTAAAATTTAAGAATCGAAGATTGTGTTGAAGGAATAAAAGCCTTCACTGAAAAACGTCATGCCCATTTCAAAAAATGA