TTHERM_00695770

Length: 306 bp

cDNA Sequence

ATGTCATCAAGTAAAGAGTTTTGTGATAAGTGCGACTCAATCAAAGAAACAGATCCTCAATATGAGACAGCTAAAAAGTTAATGATGCAATAAGGATGCTTTTAAGAAAATAAGAATTTGACAGATTGCCTAAATTTATTTCACAAAGATTGGAGATCTTGCAAAGTAAAAGCATAATTGAATTATTTGATCCTAAATATTAATTAGGCAATATATTTATTTTCTACATAAATGTCTTTTACTTTAATAAAATAGAATGAAACTGACCTCCTTACTAAATGTATATAAAACTCTAAAAAGTAATGA