TTHERM_00703410

Length: 6015 bp

cDNA Sequence

ATGGATTAGGCTTATTAGGGATAGCAAAACAATCCTTATTATTAATAATATAGTGGATAAAGACAATAGTAGTAAGGATAAGTTTATCAAAACTAACAATTCTAGGGTTAATAACTATAATACAGTAATAAAGCTTAGAATTTTCAATAATAAAATATGAATGCTGCTATGAATCAATATGAAAATTATCACCCTTCATAGCAACCTCAAATAGAAGAAGAATCTTATGATTCTTCAAATGATGAGCATACAGATGGCTACTTTGATTAAAGCAACAACCCCTCAGGTTAATTTTATAATCAAACATAAATGAATTAGTAAAATTAAATGAATCCGATTTCAAATAATAAACAAAACTAAATTTACTACAATGACATGTACTCAGATGGAAATAAACGAGATGATATTGTATCTCCAGACGATTCCCTTGCTTCTGATATAAATGATAATTAGCCATTCGAGGGCTATGAAGATTTGCAAAAAGATTTCAAAGAGGATAGAGTAAATGAAGCTTTGGATGTTTGCGAATAAATTAGAGGGCCTGCTTCCTTTATGAGACTCTTTTAGCAAATATTAAAGTTTTTGAATAATGAAGCTGTTAACAGCTTGAATTAAAACTAATTTGAAAAGTCTCTATTCATTTTAATTAAAAGTAAAGAGTTAACAGAGCTCAGTATTATCAAAAATCCCCCTTCAATTCGTGCTTTAACATTTAATAATTTTGGATGTTACTATCGAAGACTTTAACAGCTACCAAAAGCTCTAGGCTATTTAGAATAAGCCCTACGATTCTTAAACTCTATTAAATCTAGGGATTATCTAGGTATGACATATCTTAACATATCAGCTGTACTTTCACAGATGAATGAGAGAACGATAAAATTTAGTTTGTTTTTATAAGATAAACACATACATTATGCTTCATTAGAAAACGCCAAAAAAGCAGTAATTGAAATTCATAAGGATTACTAAAACTATTTAAATAGAAAGAATTATCAAGAAGCCATAAAAGACTAAGAATTTGTAGATATTTGCCAAGCTCTTGCAATTGCTTTTTACAATGTAGGAGTAGAATAAGAATTTTTCTAAAACTTCGAAGTCAGTTTGATAAATTATGGTAAGGCTTGTGAAGTATGCGAAGATAATTTAGGATCTAATCATAGATTAACTCGTCGCTTTAAAGAGCTATTTTAAAAATTTAATGAAAAATTAGTTAAATCAGAGAAAAAGTCAGCTTTAGTGCCAAAAAATCACAGGAAACTTATAAGACCTTCATCATCTCAAAAAAATATGCTAGCAAAGAATAGAAGCTTTCAAAACGTATCTTCGTATAGCAATGAGAATAATGGAGGAGAAAAAGATTAAAAGAATACTTAATTTATTCAAAGTAAAGTTAATCCTTATAGGCTTTCTTATGGGGTTAAGCCTACAGACTTTACTCAACATGGCAAAATTGTTTATTACAAAAATACCAATAATTCCTAATAATAAACAAGAACGTCTTCAGCAAATAAAATAAATGCTTCTAAAATGAGTAGGCCAAACAGCTCTAAAAGCATCTATCCTGAAATTAAATAAAATTTTCATCAAATTAGCCGTCCTTTGAGTGCAAAATTTTAAAACACACCAAATGGTGGATTCTTTGCTAATTCTTTAACTCCAAAAATTAATTCATAATCAGGGGGTCTTAGTAGACCATTTTCAGCTCAAACTACTAAAAGCAATTAGATTGCTTTCAGCTAAAATAAGGCTCCAGTTAAATCAAATTTAAGCAGGCCTTAAAATAAAAATAAAAAATAAACTAGAGATTCTTCTAAAGACAAAGAAGATGGTAATTAGAATATTTATGATTGGGTTGACTCTCCCACAAACTCTAGTGCTTCAGGAGGAACAAACAAAAAAGTTTTAGATAACTAAAAAGACTTCTTAAAAAGTATAAAGAGTGAAGCTGAAACATAAATTCAGAAATTATAGTAAGAGGAGGCAGAATTGAAAGAGCGTATTTAAAAGCTAAAGTAAGATGAAGAGGAAGAATCAAAATAGAGATAGCAAAGACTTTAAGAACAGAAAAAAAAAGAAGAAGAAGATGCAGCTAGAATAAAATAAAATTTAATTCTTGAAGAAGAAACAGAGAAAAAGAGGATAGAAGAGTTATAAAATAAAAAGAAAAAAGAGTAATAAGAATTAGAAAGGATATAAAATGAATATAAAAAGTAAAAAGAGGAAGAGTTAGAAAGAATAGCCAAGCTAAAAGAAATTAAGAAGTAATAAGAGGAAGAAATTGAAAAACTGAGATTGCAAAGAGCTAGAGAAGAAGAAGAAAAATAAAAAAAGCTTTAAGAGCTTGAAAATATTAAGAATGAAGAAGAAAACAGGTTGAAAAAATTAAAAGAGAGCATAGGTAATGAGGATACTAATAAAACTAACCTTAATAATAATTAAAATGCTAAATTTGAGGAGGAAGAAAGAATTAAGAGAGAAAAAGAAGAAATACTCAAAAAATTACAGTTAGAAAAAGCAGAAAAAGAAAGGCTCTAATAAGAGTATGAAAAAGTCAAAAAGGAGTAAGAAGAATAAAAAAGAATAGTTAATGAAAATTTGCTGCTCAAGTAAGAGAAAGATAAATTACTTGAAGAAATTTAGAAACTTTAAAATTAAAAGTAGTTTTAAGTTTAAAAGACAAACTAATAAACAATTATTTCTAATGACTAAGAAAATCAATTTAATAAGAATTAAGATAATTCACATTAGGATTAATTAGATTAATAAGAGCTCTAAAAATAAGAAGAACTTAAAAAGTAAAAGTAAGTTGAACTTGAAAAAAAACGTTTAGAAGAAATTGAAAAGTAGAAATAAATTGAGTTAGAAAATCAAAGATAGCAGGAGCTTGAAAAATAAAAATAAATTGAACTTGAAAAACAAAGATAGATTGAACTAGAAAAATAAAAATAAATTGAACTTGAAAAATAAAAATAAATTGAACTTGAAAAATAAAAATAAATTGAACTTGAAAAAAAAAGATAAGAAGAACTTGAAAAGTAAAAACTTGAAGCAGAAAAGTAAAAATAATTAGAAATTGAAAGACAAAGATAAATTGAACTAGAAAAGCAACAATTAGAAGAATAAGAAAAAATAAAATAATAATAAAATACCAGTTAAAATAATGAGTTGATTGATAAAGAATAGTCATAATAACATGAATAAAAAGAATAAGAAAAGCAAAAGTATTAACCTAACTTTTAGTGTCAAATAATAAAAAGAGTAAGCGAACACTACAATCTAGGTATCTAATCAAATGTGCTAGATTAAGTTATTGTACATGCCATTCCTATTTGGATAGATGAAAAACACCCTCATTTAAGAAGGATAATAAATTTGTCTAATATTAGTGAGGGAAAAATTAAAGATAATGTGGCAATTTCTTTAATTTAACAAATTTAAATTTCATTTTCAATCAACTCTGAAAAAAGAAAAATTAAGTTTGCAAAAAGATGGTCAACAATAATTGATTAAAAAACATTTGAATGCAATATAAGAAAAGATAGTTAAAATTTTTATTATGTAGAATTAGATAATAAAGATAATATACCTTTAATTACTTCTGTAGTTTAAAAATCTTTAAATTTTTCAATTACTAAAGCTATTGATTATGTTTGCTAATAGGAAAATTAGCACAAAGAGGATAAAAATAATAGTTTAAATGATTAACAATTAAAACTTCAATAGTAGTAATTGCATTAGCAGCAGATATAAACACAATAAAAACAAGAAGAATAAGGTATCCCAGAAGATGAGCTTACAGTAGAGAAAGTTAAATTTATTTAAGGTGCATTCAGAGATAAGAAAGTTAAAGATAAAGCTAAAGAAGATATGATCAAAGCTACTTAAGAGTTCAAATAATAATTATAAAATAGGATTGTCTAATTTGGAAGTCATAAGCTTTTTTTACAGTGTTACAGATAAATTACACCTGAAAAATATATAATTTAAGTTGATTCTCTCAATCCTAAGTAATTAAAATTACCTAAAATTAATGATCAATAGGAAGTAGAAAAAGATTTTATTGAAAAAGTAATGCAATCTGAAAATCCATTTTTTGAGCAACTAATTTATCTCAATGAAGAAAAAGGAAAAATTTTCTTTTAGCAAAATTAATAAAAATAATAATTAGAAAATAAAGATTTTATCAAAAAAGAAGATAGTTAAAATGACATAAATAATAAATAATCGATGTAAAATCAAAGTTAATTTTCTTTTGACCAAAAAAATCAGAAAGAAGAATTAAATGTAAAAGATAAAACTTTATCTGAAAACTCTTATTTAGAATCACTAAACCAATCTGAAGTTTTTTCTGAAAAATAAAAATAAAATTTATCTGCTAATGCTTAAAAAGTTTAAACTTAGCAAAATCTTGAAAAATAAAATTAATCTGATTTGCAAAAAGAGAAAGAAGACAAATCAAAATAGCAATAACAAGAAGACAAGGATGAATATTATGATGAAGATTTTAAAGATGAAGAAGTTTTATCAAGTCCATAAAATTTAAAGAAACAAGATAAAATAGAAGAAGAGCAAAATGCTGATTATTCGTTTGAAAGTGTGGAGGACAAAGGGACAAAAGAGTAAAGTAAAAACTTAGATTTATCAAATTAAGAGTTAATTGAATCTAAGTTAGTTGAGAAGAAGTAAGAATTTACTGAAGATCAATAAGTAGCAGCTTTAAAAATATAAAAAAACTTCAAGTAGCTAAAAAGCAATTAAGCAAAAGAAGTAATCGTCAAGAAATAATTCTTTTCATTAAGATTAAATGACGATAATGGAGACATTTAACTTGTTTAAGGTGAATGCCATATAACTTTATAAAACAAGAGCTACTTTTTAATATTGCTAAAAAGTGAATCTATTGATGATCTTAATCCTCATATGACATAATAGCAGAAAATAGAATTAGGGAAGTTAAATAAAAAACAAAAGTAGCAACTCTTTTCAAATTTTTCAACACTTGTTAATTGCAATATTGGATTTAATCAAAATCATTTAGTTTTCGAAGACATAAACATTACACATCTACGCGTCTATTCTGATAGAATATCAGTAAAATAGTTAGAATTACTTAATAAAAAATTAGAAAGCTAACTCTCTTTTGTTTCAGAGCAGGAAGCTCAAGTAAAATTTTCTTACTATTTAAAAGATATATTGATACTTTTTATATTAAAATTTTAAATAATAAATCAAATCTTACAAAATAAAAAAAAAAGTTTAGTAGAAATGTTCAAAACTCTTGACGATTTAAAAGGAAAGAAAGACGATAAGAAAGATAATAAAAAAACTAATTCATATGCAGGAGGTGAAAAAAGTGGACTTGCAGTTGAAAATCCAGATGACATTAATGGTATTATTGAAAAGGCTGAAAAAAATACAACTTCAGATGAAGGTAAAGGAGGTAAAAGCAGAAACGATGAAGTGAAATGCAAAATTACTCTCTACCAAAATGGTTTTTGTATTGATGATGGAGAATTCAGAGACTATAATGCCCCTGAAAATAAGCAATTTATGAAAGAACTTAATTAATAGATTGTCCCAATGGAACTTAGAAAGAAGTATCCCCAAGGAGGACTTTCAGTAAGTCTAGAGGATAAAAGGTCTGAAGCATATAGACCACCAACTCCACCCAAATATGTAGCATTTTCAGGATAAGGTTAATCTCTTGGCGGAGCAAGCACATAATCTCAAGCCTTAGAGGTTAACTTGAAGAACGGAGAAATTATAGTTGATGAAACTAAGCCCGTCACCAATATTTAAATTAGATTGCATAATGGTAAAACAGTTAAGATCAAAATTAACACTTCTAGCAAAGTGAGCGTTCTTTATGACTATGTTACTTAAATCGCTCCTGTTGATGGAAGTTTTGAATTAATTAGCGGTTTCCCTCCTAGACCTCTCACCTAATTTAACCAAACTATTTAAGAAGCTGATTTGTTAGATTCAAGAGTTACTTAAAAAATAGTTCATTGA