TTHERM_00705190

Length: 456 bp

cDNA Sequence

ATGATTAATAATTGCAAAAAGTTAATCTATCAGTAACTCTAAAAATTAGTAAATAACAATTACAAGAAAAAACCAAAGGACATGAGATTGCTTTCCCACAATTTACTCTAGTGCAACGTTAAAAATTGCAAATCAAATAATTTCCCCTTGAAGATTTAGGTCGATAAATCCAACATTATAAATTGCGAATTCCGTAAGGAACCTCTTGTTAAGCTCATTCCTAAATTAGATTGGAATGCCTTAGCTATTACTGTCCATAATCTTGCTAAGAATAAAGAATTCCCTGAAAAATTTAGCCCTGCTCTCTTAGATGATTAAAAGTTTATGCAAGAATTACACAGAATTTTGATGGAAACTCATATTATTGAAGGTGCTTTAATCTGTGAAGGTTGCAATAAGAGATATCCCATTAAAAATGGTATCCCCAACATGATTTTAAATGATGAAGAAGTTTGA