TTHERM_00711780

Length: 1020 bp

cDNA Sequence

ATGTCATCAACTACTTCTAACTAAGCAGCTGTTTAAAACCACGTTGCTATAACAGAAGCCCTATAGCAAAAAAATAATATTTAAAAGGACGGAATTAAAATTGATTATAAGCACTCAGCCTTTGTTGAGTTTTGTAAATATATGACAGGTCCTGCAGTAGTTTAAGCAGTTAATAAGACAATTTTCGCTCCTTTAGAAAGAATGAAGATCATACATCAAGCTTAAAATGCTCTCTATATAAATGAAAAAGCTAAATTTAAGAATTTCTTCTAATTCCTTTAGAGAATACCTACTGAGCAAGGTATTAAGGCTTACTGGAGAGGAAATTTTGCCAATATTATGTACATTATACCCCGTACTATAGCATAGTTTGCATTCTTTGAAAATATTAATCACTTTTTCTTCCCTGCAGGTGAAAAGAATATAACCGAGTTAGAATACGCTTTAAGAAAATTTAGTGCAGCTTTAACTGCAGGTTTTTGCACTCTTTCATTAGCATACCCATTTGATTTAGCTAAAACAAGATTATCATTAGAATTTGCAAAAAATAAATATGATAAGTAGTTCACTGGTGTTTTGAGTGCTTTAGGAGAAACTAGAAGAAGAGGTGGTTTCACTGGATTATATAAAGGCTTTTGGCTTGCTAACTTCACCAATATTCCTTATTATTTAACCCTCTTTACAAATTTATAGATTTTCAAATCCATGAATTAAAGTGAAGTCTCTAATTCAGAGCTATTTTAATATTTAGCTCCTGCTTCTATTGCTGGCTTAGTCAGCACTCTTGTTGTATATCCTTTAGACACCGTCAAGAGAAGACTTTAAATTAATGGATATAATGGAAATTTCATGTATAAAGGAACTTGGGATTGTTTCAAGAAGATTTGGGATAAGGAAGGTGCTTTAAGCTTATATAGAGGAATAACTATTACTTCAGTTAAATTTTTAGGAAGTGCTGCTCTTTAAACTATTCTTGTTGCTTATTATTCTTAACTTAAAAAATAATACTCATTATTTTGA