TTHERM_00721370

Length: 1425 bp

cDNA Sequence

ATGGGAAACTAGGAAATCAAAGGAAGCTTAGGATAAGGCTAGGGTTATAGAGTAATATCAGTTTCAGATGGTTCTCCTTGCCATTAGGCAGGAATTAATTTCTTTACTGATTTTATCGTTGACATTATTCCTGCAGGATAAAATAATGAGGAAAATGCAGATGATAACAATATTTTAGAATTTAATGGAGATGGATAGTATGTGGTTGATGAAAAGAAAGATTTTTTTTAAATTGTTTCTGAACACGAAAATAAGCAGCTTAAAATGGTTATATATGATATTTTGCAAAGAAAGATTAGAATAGTGAAAGTAGTGCCTAATAAAGATTGGTCTAATCAACAAAATTTGCTTGGTGTTATGCTAAGATTAGAAAACTACTTAAATTCCCATGATAACACATTTAAAGTAGTAACCGTTGATGAAAACAGTCCTGCTAAAATTGCAGGCTTATAAGCAAAATAAGATTACATAATAGGATTAAAGAAGTACAAGTATGAAGGATTGGATGAGTTAATTAATATTATATTTGATAATGAAGGCTAAGAAATAGAGTTAGTAGTTTTCAACATTAGCGATAAATCAGTCAGAAGCGTTATGCTTAAACCCTAAATGAATTGGGGTGGCAGAGGATTGATCGGGTGTGAATTTGGAGGTGGTTATTTAAATTAATTACCTGTTATTTTAGATGAAGCTGCTGAGCTTTAAAGAATGGAAGAAGAATAAAAAAAATTAGACTCGCTTAACAAATTTATTCATAAGAGTGATCCACCAGCTCCCAAATAATAGCTTTCATCTGATCCTCCACCCACTAATATTCAAGTTTAGTAAGAATAGTAACAACCTTCTCAAAGTGGATCCAAAATTGTTGCCCATTAGCTTCACTAAATTAATATACTTAGAGCTAAAAAAAATTCTCACCACGAACATGTGGAAGTAGTTCATAACAAAGATCCATTTGCAGTTTAAAGAAAGTATTCGAATGATATTTAATAGTAAAATGAAGTGAAAAGTGTTGATACATAAAATTAAAATGTAGAATAAAACAACAGAAGAAATTCATCTTCCTAGTTTAATTAAAGCTAATAAAATGGTTAACAGTAGGAAAACAGATAGGTTTCAAAGTCTTTAACTAGCCAAAGCATTCAAAACAATAATATAAATCAAGCTCAAAATCCAGAATAATTTTCATCTAATATATTGGAGAGATAAAATGAAACCAAAGAAAAAAGCAAATCTTAGACATTTTAATAACAATAGTAAGTTGTGTTTTAAAATGATGAACTAATAAATTAATCAAGAAAAGAATCTCTTAGCAATAGGCAATACGAATTTGAGGTTCCAAATATATAGAAAAAATATATAATTATGGAAAAAGATTTATTTAACTTAAAAATCAAATTACAAAATTAGCAATTAGTTATATGA