TTHERM_00721790

Length: 1476 bp

cDNA Sequence

TAAGAGAAAAAAGTCTTATTTGATAATTAATAAATAAATAGTAAAAGGCACACAATGTTCAGAAGAATAATTTCAAATGGTGCTTTATTGAGCACTTAAACCCAAAGATGGTAAGACTTATCTAAATTCGCTTGCCTTAGAGCTTCTCTTAACAAGGAATCCGAAAAGGCTTTCTAAGAGCTTGCTAAAAAGAACAACGTTTCACCCTAAGAATTAGTTGAACTTAGCAAGATTGTCTCTATGAATTTAGACGTCCTTAAGCAAAACATTAACTCTGAGTAATTCCTTTTAGAAAAGGAATCTACTCTCAAGAGATACAGATAATCCAGCATTGGTACCAGAGGTCATCTCCAAACTGTCAATGAAGCTGTTAACACCAAATACCCTACTTTGGCTGAAGGATTAGGTCAAGTCGCTGGTTACAAGGAAGCTTACTAAGCTTTAAGAGAAATCTTTGTTCATCCTTCTATTTCTGTCAATAACTTAAGATAAGGTTCTTATGGTCAATAATTTGCTGTTGATTTCAGAACTAGAGCTGATGAATACGTTAAGGCCCTCTTAAAGGATCACTCCAGCAACCCTCAAGCTGTCTAAACCATATAAGAAATTCAACACACTCTTCATTAAATTATTAAAAACTACGAATAAAATCCTGCTTCTATTTATGCACGTATTTTGACTGTCCTCTAAACCAGAGGTGTCAACACTTTACCCGTCTCCAAAACTGCTGACTAAAAGGCTGTTGCTACTATCCAAAAAACTTCAACTCCTTCTCTTACCATTGACTAATTGACTGTCCCTGTTTAGGAAAGAGTTTAAACTTAAACTGTCTTTGATGCCGAATTAGCCTTCATTAAGGAAGCTAATGAAATGATTCAACAAAATACTGGTAACTTACCTTGGGATGGTGGCAAAAAGAAAATCTTCTAAGGTTAAGCCAATAAGTACTTAGAAACTCCCTACTACTTACTTGCCGCTCTTTCTGGTTTGGGATTACTTTACTTCTTATACAGTGGTGACGCTAAATACAAAACCTTAGTTTTGACTCCTGTTGTTGGTATTGCTGCCTTCGTTTTATTAAGAAGAAACTAAATTTTAAATAGAGTCCCTACTTTAACTGAATTATTCTTACATAAGGACGGTAAGTTTGTTGATGCTGTTGTTTCTGTCAATGGATAATTGATTAGCAAGAACGACATTCCAGTTTCTACTCTTAAATTATACAGAGGTGACCACACTGTTAAGGTTAACTTAAATGACTTCGAAGATGCTTCTGCCAAGAAGTTCTTAGCTTAATAATCAGGATAAGAAGGAGTCATTAACGTTCACTTCTCTAAACTTAGAAATTTGGCTGCTAGAAACGGTTAGGTTTTGAATTTGGGAGATACTGAAGTTGTTGTTCCTTTCGAAAACTAAGCAAATAGAATCATCTTAAAGCAAATCTTCAAGGGAGTTGAAGTTCTTCCTTCTTCTTGA