TTHERM_00723090

Length: 1353 bp

cDNA Sequence

ATGAGTGACCCTATTCTAGCATAATTTAAAGAGGCGCTTAGGATATCTCTACTATATTTTATTCATTTTGCAGTTTTCATCCAGTGTTTCCTCATGTCCACTCTTCTTTATATCTTAAGAATAATTCTACACCTTTTCACAGCAATCCCTCAATTAAAACACTTGAGAAAATCTTTGATGAGATTTTTACCTTAAATCAATCCTGATGTTTATGCTAAAGCAGAGGATTTAATTATGAGTCACATTGAATACAACATTGAAACTCATAAAATTCTCACTGAAGATGGTTACTATTTAACAGCCTGGCGTATTCTTTCTTCAGATAAGAAGAAATCTTAAGAAGCTCGCAGCAAAGCTCCCGTCATTTTGATGCATGGACTTTTAGATTGCAGTTTTTCTTGGTTTGTTAATAAAGAAAGATAGATGTGCTTGCCTTATATTTTGGCAGACTAGGGCTATGACGTTTGGTGCATGAATAACCGCGGTAATAGATACTCCTTAGGTCATAAGTACTTCAAACATATTAAATCAAATCCTCATTATTGGAACTATGGCTTTGATGAGCTAGCAAAATATGACGTTAAAGCTAATGTCTAATATGTTTTAGACACTACAAGCCACTCAAAAGTGTTTTATGTAGGCCACTCTTAAGGCTCTACTTAAATGTTTGCAAAATTAATGGAAGATCCTTAATTCTAAGAAAAAATTAAAGCTTTCATTGCTCTCGGTCCAGCTATTTATATTTAAAACTTGGCAAGCAATTTCGTAAAGAAAATGTTTGGATGTGGTTTCTATCAACTTTTAGATAAATTGGGATACAGAAACTTCTTAGTGCTACCTAAATCCATTTCTAGAAGAGTTGGAGCACTGTGCCACTATTTACCATTTTTATATGATATCGGTCTATTTAAAGTTATGAATTTACTTTGCGGCTTCCCTGTTGAAAATAAAATTCCTCGTGACAAAATTTCAGTTATTGTAACACACGAACCTGGTGGTGCTTCAGTTAGAAATATTTTATAATGGGAACAATTCATGAAATCTGGAGAGTTTAAAAAGTTTGATTTTGGAGCTTAAAAGAATATGAAGGTATATGGATAAACAAAACCTCCTTGCTATAATACAGAGAATCTTAAAAAGATAACAATTCCTCAACACTTGTTTATTGGTACTTCAGATATTGTTGGAAATAAAATAGATACTGATCGCTTACTATAACTAGTTAATCCTGATTCTTCCAAGATATATACGCTAAATGACTATGCCCATCTTGACTATGTATGGGGAACTGATGCTAACACTGTACTTTACCCCTAAATAATAAAAATATTAAAAGCTCACCAAACAACATGA