TTHERM_00725960

Length: 738 bp

cDNA Sequence

ATGTTTAGAAACCTTTTAGTGTCTGCTCTAAATTAGAAAAGATAGTCTTTATTTTAGACTGTTAGAAGAAATTTTTTAACTAAAAAAGTAGATAACAGCTAAGAATTAACTTAATTTTTAACAGAAACCAAAGTAGTTGATTCTAAAGTTTTTGAAACATTCAAAGCCATGACTGCAAATTAAGATAAAATATTTATTTTCAAGATCCACGGACTTTCTCATTTCTTCTTTACTTATTGCAGATTTTCTGTTTTTGCATTAGCGTTGGCTACTATGGCACATCTTGGATATTACTATGACAAGAAGATGGAAAAATATAAAGAAAATAATTATGAAAATAGATAAAAAAGGTCAAAAATCAATTTTGCTACTGGCGCTTTAGTATTATTTACTATTGGTGGAAATGTTATATCTTTTATTATGGGAAAGAGATATTTAAAGTCAATTAATTACTTGCCAAAAACCAATTAATTTGAATTTAATTTCTATGGGTTAATATGCTAAGACAAGCCCTACAAGGTTGAGCTTAATGAAGTATTTAGAGTTTAAAGAAAGTTGCTTGATTAGACAGTCTAATTCTAAATATAAAATAAAAATTGTCCCCATACTTATTTCTCATCAAAAGGAACTGGTTGGTGGTCAAATAAAAAGCTATTTGAATATATTGTAGATTAAAATAAATTATCAGAAATGCCAAAATAACAAAAAATAAAAAAATTAGATAAATAAGAAAAATGA