TTHERM_00726050

Length: 2403 bp

cDNA Sequence

ATGAAGACTGGACTTTTAGCAAACATTATTTCAAGCAGAAATATTATTATATAGAAAAAAAACAAGCCTCCTATTGAATTAAAATTAGCAAATTGGTAAAATATACCTTTGTTTGAATCATTTTCAAAAGATGATGAACCTGGTGGCTTAGAAGCAAAGCAGTTTTTGTGTTAATTTGTAAGATAAAAAATAAAATTTTAAGTTGATAAATCAACCCAGGAAGTAGTTATATGGGATGACGAATAAGACTAATCAAAGAGTATTAATGATTAGTTACTATCTTTCTTAGCTTCTAATAACTTTAATAAGTAGTACTCTAAGACAATCAACGATTATACTGTTCCAATTTCAAGAGATTTATACAATTAAATAACTATTAAAGCTAATTAAACTTATGAATTTTTTTTTGATGAAATAAATTCTGAAGGATAGTTCATAGCTTTTGAAAAAAATACAAATACATTGATAGTTTTTTAACCATAATTTGTTAAAATACCTGTTATTGGTCCTTAGTATAAGTAATTCCTAGATGCCAATTTACTTGATAATCAAATACTCTCAAAAACTCATACAATTTGCATTTCCTCATTAGAATATGATTCAAAAAAAACTCTCATTTTTAATGGTCTATTTGATAAGATAAGTGTTCTATTAAAAGATGGTGTAGCAAGCTTAACAGATATGGCATTCCTCTCTATCAAAGATTAGGATTTACTTGAGTAATATGATGAATATATATGCTAAGCATAAGCAGAAAACAAAGGTATTTGGGGTAAATAAACTGATTTTGATTCACTGATCACTAGAATAGATTCATTCCTTGGAATTGTACGCGAAGTTGAATCTGGTATAGTTTTAGTTATAGAAAGAATAGGTGAAGAGCAAAGCTAGTCTAAGATGATAAAAATTTAGCTTAGTAAAATTTAATGTCCATAAGGATTAGAAAGAGGTGCTTTTGAAGCGAGAGAGTATCTAAGAAAGCTTGTCATAGGTGCTGAAGTCGATGTTTTCTTAGAAAAAGAATAGGGATTTTTGCAATGCGCCACTGTTATAATTTCTAGCTCTTAACTCAACTTAAATTAATATTTAGTAAGTAACGGATATGCAAAAATAAAAGAAGAATTCAAAGGAAATTTTACAGACCACAAATGGATTTAGACTGAACTTGATTAGAAGCTAGCAATTTAAAATTAAAAAGGTATACATAATAAAGATTTGGGTATTATGAGATTAAAAGAGATTGGAGTAAAGGAGACATTAGAATTATACTAAACTTAGATTAAATAAAACATGAATAAGGAATAGTATTAGTGTATAGTTGAAAAAGTTCTCACTGGTGACAGATTACTTATGAGATTTATCAGCTTTAGTGTAATTGTCAAAGTCAAATTATTTGGTATTAAATGTTTCCAAAATGATCCTAATTAGCCTACTCTGTAGGAAAACTACAGGAAATCAATTGATTATAACTACAAGACTCTTATGAATAGAAATGTCTAAGTTGACGTTATAGGCTTACATGATGGTTGCTTGTTGTGTAAAACTGATAATTATGATTCAATTTATGAAGCCTGCTAGGAAAAAGCTAAATAGGAAAAAAGAGGTATTTGGGAACATGAAAAAGTAGATGTGTTACTAGAATTACATGATAACACAAGCTCGATGTTGAAATTTATTAAACAAAGCAGTTCATAAGGTGACTGCAAAGTACCTGTACATATATCTTAAATTAAAAGTGCCAATGAATTTTATGTAATCTATGAAAATAACCCAATTTAGAAATAGATAGATGACTTAGTTGATAGTTATGACTTGCCTAAGCTGTAAAAACTTAAAGTTATCAAATAAAAAACTTTATGTGTTGCTAAAAGTGAATAAGATGGTAAACTATATAGAGGTAAAATTGTTCAGAAGCCAGCTAATTCTTAAGTTGACGTTGAATTTATTGATTATGGTTTGATTGAAAAATTGCCCACTGCTAATCTTTACTAGCTACCAACAGATTTAGCTAAATACGAGGCATAATGCTAGCTCTGCACATTAGCATATGTAAAAGTACCATTTGGAAACCATAAACTTGCAAAAGCTGCTAAAAAAGAATTTGAAAAGTTACTTGATAATGGATATGTTGAAGCAGAATTTGTTTAAGCAGGAGGAAATCTAACTAGCATAATACTTACATTTGAGAATGAACCTGAGCTCGATAGATCTATTAATGCACTAATGATATAATCTGGATTTGCTAGAATAAACTTTAATATACCAAATAATCCTTTCTCAGATGAATTATTCTAAGATCTAGAGTACGATGCGACTGATTAATAAATTGGAATTTGGGCTCTGAATAATCAAGATAGATTATCTGATGACGAAGGAGATAGTAGTGATAGTTATGACTATTGA