TTHERM_00728900

Length: 1161 bp

cDNA Sequence

ATGGAAAACGAGATATACTGCAGTATCCATAAAAATAAATTAATTGATGCTGTTTGTCTAGAAAAAGAATGCTCTGAAAACTCTCTAATATGCTATAACTGTAGAGATACTCATCAAGATCATATTTAATCTTGCATTCATTTGTAAGATCTCATTGAGAACATCGAGAGTAGATTTAATCTATCTGTAAAGTTCAGAAATTTTGGAATGAACAAGTAAAAAGAAAACATTTTTATCCTTGAATAGGCTAAAAATCAATTTAAAATTTCCAAGAAAAATGAAAAAAATAATAGCTAAATGTTAAATAGCTTAGATCGTAGGTAAAACTCCTTAGAAATTGTGCATCAGGATCTCATTAATAAAGAGTTCTAGTAATCTCAATAATATTATTAATAGATAGCAGATGATGTAATTCAATATATGAATAATTTTGAAACATTATGGAGAAATCAAACTAAAAATTCTGCCTTTATTTAAGAGATTAGCTCACCCTTAACAAATAGCAGAACTTAAATAAACAACACTTGTTTATAGAAAATACATTAAGATATTGAAAATGGTATTTTAAAAAAAGAAAACCCATATCAACAATTTTTATAAAGTAGTTCTAAACAAAATTAATAAAATATTCATAATTAAATTTACGATGATGAAAAAAGATAAATTGATTAAACTTTTAAAAATAATTATATCAACAGAGATTACGAACAAAAATTTGAAAACAATGATTAAGTTGTCCAAATTAATGCAACCAGATGTGAGCAGTCACCTAAAATTTTAAAGGAAGTTTAAGCACCATTATTTGGCAATTTTTAGCAAAGCATTATATTTAACTAAAATTAAATCAATGACGATTTATAGCAAATAGGTTCTTAAAGATTATATAATGATAAATAGAATTGCTTTTAAAACTCATCATTAATGAACACTAAACCTCAGTAAAATTATGGCCTTGAGAATTCGTAAGCTATAAAATAATATACATTTAGCGATGAATAAAAATTCAATAGAGCTTCTTCTGAAAATTTAGCTGGAAAAAAATCAATAAATTCTCAATCAACAAATACTCATAAAAGTAGCAATAGATACTAAAGTAAAGAATAGAAATCTTAAGATTAATAACAATAATCATAATTAGATTCAAAATAAGCATAAGTTTGA