TTHERM_00729020

Length: 4047 bp

cDNA Sequence

ATGAAGCATTCAACCTAAAAGAGCATAGCTTCCTTTTGCTTCGATTTAGAAATTTCTTTCTATAACAGCATTTGCTCTTCTTAAATAAATACTGAAATTTAGTAAAATTTTAAAAAGGGTAGTTTTTATTTTTCATAAATAATGGAATTCTTGTAATCTTATTTTTTGAATTTTGGTTTTAATTCATTCAATCAATCTTAAATAAATAATAATTTCAACTATTTTATCTTTTAAAAAATAATGTAAAATCCATATTTTACTACCGCTAAAAGCAATTAAGCAAATGAAACTGGGCCTGGTAGCTTAAAATATGATTTAAAAAATAAATATGCTTCTACTGCCATTAAGCGTGATGGAACAACCAATGAAAATAATACAAATATATTTGCTTCTTAGCCAGCTAATCAGTAGCCATTATAATAAATGAATAAGGATAACTCAATATTTTAAGGATAGAAATAATTTTAATCCTAAATAAATCAAAGTTAAAGACAATCAAACTAACCATAATACAGTAAAATATTTAGTGCGAATAACTCAATTCCTGCTTCGCCTCATTTAGACCGTCCTTCTGATCGTTTACCAACTCATAACTAATCTTATCTAAATACTAATAATCCTGTAGGAATCCAAATACCTTAACAATATAATTCTATATTTAACTAAAATCCAAATAAAAACTAACCTTCCTTTAGCTATTAGAGATCTGTTCATGGAGCTGACTCCTTTAAGTAGAGTAATAATAATAGCTTTTTGAATTAGAGTGCTCTAAACAATACATAGGCATAAAACTATCATGTTATAGCTCAGTAGAAAGGCTATTAATAATTAGAAGATGCAAAAATATTTAACAGTGATCCTCTCATTTCTAAAGCTGAAAAAACGATAGAATAAATTAAAGAAAACTCAAATATTTTATAAAATATTGTAGAAAAAAGAAGAAAAATATTTTATGATTACGACAGCTGTCTAGATAAAATAGATATTTAAAAAAAGAAACTTAATTAATGTTCTAAAAGTGATTCTAAGCAGTTCTTTCAGCAAAAGACATCACACGAGCTTCTACTATTTAAAGATAAAAAGCAGGAATTAGTGAAGATCAAAGATGAATGCTTGGAGATGATAGGATATTATGAAAAACTAAAACAAAAAGGACTAGCTCTGAGATTGTAAAAGTACTAAAACACTTAAGAGATAAATTATTAACAAGATGTATTTGAATTTGAAAGTATGTACTTAAGAATTCAAGATGAATATTAGAGTAAGACGACTCTGCTAGAAGAGTTAGTTGAAAATTATAAAAAACATTTCAAATTTGATAAGACGAGTGAAAAATTTACTGAAAAATAGCAATAGCTTTCAATGTAGGTCAAAGAAATTGAGAATAGTGATACTATCAATTCAAACTTAAGCATGCTTATTGATGATTTTCTTATTACTTTGAAAGCCTTAATTGAAGAAGTGGAAGAAAATATAGAATTTAATGAAATTCTACTTTCTAGCTATTAAGAAAGCTTCAATTATGTTTAATAAATATTATTTTACAGAAATGAAAAAATTCCTGAGTTAGATAACAAGATTAAAAATATTAGAAATAATATACAACAATATTTAAATAATAGGACAAACCGTTCATAGTAAGCTTCTGGTTATATATAACTAGCATAAAAGGAATCATAAGAAGTTAGGGAATAGTTTAAAAAAATTAAAAAGTAAGCAAAGCAAACTCATTCGTCTTAAAACAGTATGTTCTTTATATAGTTAAGAAGTAAACAAATAACGAAATTAGTAAGCACTATTAATGATATTTATTCAAAAACATTAGATGAGGTGGATAAGCTGGTCAACTATATATCATAAGGATAGCTTGCTAATGATGAGTTATACTGTTAAAATATCATTAATAATGGAAAATAATTACTACTTACTCTCAACGTATAATAATCCCCAGAACAAGGCAAAGTAATGTTATAAAAAACTCAAGTTTAGTTATCTTTACTTCTTGAGTTATAGGATAGACTTTAAAATCTATCTTAATAATCTGAATTTAGTCTAATTAATCCAATTATCTCATAAATGAGCTTGCTTTTATCTTAGTAAATAGCTGAAATCAAAACAGAACAACAAAAAATATTCCCTTTGATAAAATACGAAAATGAAACTAGAGAGTTTAGAATGAAAAGATAAGAAATTCAGTAAACTTTAGAGAAAGCTAAAGAAATCATCAATTTTTAAAAACAAAATTTTATGCTATCTTTTTAATTTGAAGATAATTAGAAGTAATTCTTAAGCATTTTGCAAGTTAATTTGAAATTGCAATAATACTAAAAATTACTGAACCAACTCCTTTAATTTTTTTAAAACTCTCGGTAAGCATCCTACTCACCTTTTGATCCCTAAACAATTACTTAAAACTCATAAGATATCCATCAGCTATTATCAGCCATAGATTACAATAAGACAAACATACATCTTATAACTACTCTACTAGAATCTTGTAATAGTGTATCTCCAACTAGCATAGGAAATTTAAATTTTTAAGTAGATTCAGAAAAAAATAAGCTCTCATCAAATATAAATACTTATCTGAGATAGGAATATAACAGACCAAACTACATGAACAAAGTAGAGTAAGTTTTACTAAAAAAATTAATTTCCATGTAGTCAATTCTTGTGTAAGTTTAAAATATCTTTGTTTATTGGCTAAAGAGTGGAGATGAAATTACATCAAAAGTAATCCACCTCAGAAAAAACTATGAAAATTACTAGCATCAGTATATTGATCAACGTTTATATGATATTATCTAAGATAATCTTGAAGAACTTGATTTAATGATTTAAGAAACAAGCATCGCCCCTGAGCTATAAGACTGCTTTAAATTTAATATCAAGTCTTACACAGAGTGTCTTGTAAGATATGCTGTTTAATTGGAAAGAAAAGTATTAAACCCATATTCAGCAAATTACTTGATAAATTGGTTGGAAAAAAATTATTAGAATGCTCTTTCTTCTATTACGTATCTATTTGATATGGATGATTTAATTTGGTACTAGTAGGGTAATGATAATGATGATATTGGAATTCAGTTGAAATTGCTAAGGAGTAGGTTAACAGAATCTTTACTTCAATAGCAAAGTTTGGGTTTATTATTTAATCAATAAAATATTATTGCAAATATTAAGCTGGATCTACTACTTTAAGTAGTACTCAAGGATAGCATTCTTTATGATTACAGGGCTATTGAATAGCTACTAAGTATTGGGAAGTTATTTAATTTGCATGTGAGACAAAGCTTTGAAATAAGAAGAGTGCTTGAAGAAAAATATTAGAACACACTTAGTTTAAGATAAAATTAAAATGATTTAGATTAGCTTGTAAGAATTCTATCAAAATATTAAAAAACAGTGGCATTTAATCTTGAAAGAAGAGAGATTATTTTAAAAAGCTAAGTTATGAGTGATGAACTTAAAAGACAAGTCTTAATTTAGGCTGACAAAAATCAAAGCATGCTAATGAATATTTTAAATATTGATTAAAATTTACCTGATAGCATTATGTAAATGTACAACTTTTTAAAATCATACGTTAAAATCTTACCTTTTTTGAATAATGACTCGATTGGCCATGCTTTCTAAGAAGATTATCTGTTTGATTATATCTTTAATTCAAGTAGTAATATTAGTTTACGTCAAGCTCTTGAGTAACATAAATAAGCTGTAGAAATCTTACTTGATGGTAATTTTATTGAAACAGTAAGATAGATTTATTTCAGAGAAAAAGAAATTGTTGATCGAATTAAGCTAGATAAAAAATTAGGATTGTTTGAATACGTTTAAGATTGTTAAATTATAAAAGATTTACGTAGCAATATAGATCTAATTAAATGGAGAGAGATCATTTAAAAATCTATCAATTTATTAACTTAGGATGTCATTAATTCCATCTAAGCATAATAAATTTAATAAGAATTCTCCAGAATAAACTAACTCAATAGAAAATAACAAATATTCGTTAACAAATTCATTATGTCCCAAACATAAAAATGA