TTHERM_00729160

Length: 1446 bp

cDNA Sequence

ATGGACACATTATTAGATAAGAAAGATATTAATGCAAATGATAAAGATTTGCTAAAGAAAAAGAAGAAAAACACATTTAGCTAAAAGGAAGTTTTTAGTGATGGCTATGATACAGATGGGTATAAAGATGAAGAAGATAGAAAGAAGTTAAATTAAATGAATGAAGTTGATAGAGTAAATGAATTGAATAGAAGATTGGAGGAAAGAAATAATAAAAAATTTGATGACAAAATAGCAGAAAAGGCAGAAAAAGTTAAAACAACTGCAGGAGCTGCAGTAGCATCTAATATTTTTGTAGATCCTACCAATGGCTTAGACTAATCTAAAAAGAGTTAAGTAGAAAAGGATAAAATGCAGCTAAAAAAAGAATTAGAAACAAAAAGAGAAAAGTTAAAAGACTCAAATTCTCATTCTAATAATAATAATGATTATAATTTTTCACAATATGATGATTTTAAGAGTTAAACTCATGGTCTAGCTCAGCACTAAAGAGAAAGAAATACTTAGAGTGAAGAATTTTAAAAATTAGTTAAATAGCTAACTCTCTCAAAAGATTATCTAAACAAGTTACTACTTCGTTCTTATTTTCATGAATTAGTTAAGGGAGTATATGTTAAAGTTAGAATAGGAACAAAATACGAAATCTATAAAATAGAAGGTGCTCATTCTGAAGGTAATAATACTGTTTTTACATTAAATAATGGACTCAAGACCAGAAAAATAGATTTACAATATATTTCAAACTAAAATCCTGATCAAGTTGAGCTATGTACTTACTATGAATAAAATAAACATGAAAAACTTCAGAGCTTAGTTGATAAAAAGAAGTAGTTTGATGACTTGATAAATAAAAAGTAAGAAAAGAGTGAGAAGCAAAAATATTAAGAGATAGACTAGCAAATTTCCTAAAAAATAGAGCAAGGATATTATGAAAAGCAGAATAATTTAAATGCTAATGAAATTTAAACTAATATTGGTTTTTACAAAGATAGAATATTAGATATAGATTATATTGAGCAAAATTAGATATAAGTAGGTAAGTCAGAATTGGAAAAGCTCTAAAAAGACAAAGTTAGATTTTAAAAAAATGTAGAATACTTGTAAAAGTAAATTAAACTTGTTAAGCACTAAATAGTACCAATTTTTACCAAAAATGTTCTTGAAATGGGTTCTAAAATCAGTGAATAGGCACTAAATAAAAAAAATGCAAAAATTAAAGACAAAGCCATGATAAGAAGATAGAAAATTCAAAAATTACAATAACCATATTTTGCCTTCGAAGAATAATTCAAGCAACTTTCTCAATACTCTACATCTATTTTATTGAAGGAAATAATTAAAAATAATCATTCAAGCTTGCACCTTTCATCCTAAATATAAAAAGACTTAAGTCTTATTGATTGTTCTGATTAAACAATGCAATCTTTGATTTCTAACAAAAAATGA