TTHERM_00730270

Length: 162 bp

cDNA Sequence

ATGGGTAGCTTTGATTATGACTGGGACAAAATATAGTAATACACAGAATTCATTCAAGAGTATATTGTATGTTGCGGATTATACGTATCTCAAGGAAACGCGAATATTAACCCCCTCTTCTTCCCTTTAACATATTAGGAACGTCGAGAATCTTCTTGTTGA