TTHERM_00732520

Length: 1080 bp

cDNA Sequence

ATGGAAGAAACTTAAGACTAACCTGTTGATGTAAGAGCATTAGCAAAAAAGAAATACGAGTTATATTTATAATAAAAAAAAGCTCATGAAGAATTGGAAAGGTTAGGCTTAACAAATGAGTAAATAGAAGCTAGGATTAATTCTTCCTCACAACAGCAAACACAATCAAAGAAATAAGAAGGAGAATTTTAGAAATTTTAATAATAGTAGAGTTTGGCATCAAATAAATAGAGTAATGATTATGATAGATAGTAATAGAGAAACTAAATACTCACAGAGCTAACGATGAAAATAACTGAAAAATTTCAAAAGGAGCTAGCTCAAGACTCAAAAAATAAATCTAAATAGAAAGAAGGAATGTAATTAGAGTAAAAAATTTCAAAAGAAATAGAAAACTGTACTTGCCCAATATGCTATGAATTGATGGTTCCACCAAACAACTCTCCTATTCTTATATTTCCTTGTGGACATACTTTTTGTAAAACTTGCATTATTCCAAAAGATAAAACCAAACTTAATAAATGCCCTTTTTGTAGAAAACCTCTCTAATCTTATGCTGTAAATATACATCTTTAGAATATTATATGTGCATATACAGATAATAAGCATTTGTTAGAAAAATACAAAGACGAAATAGAAGATATTAATAACTCCTGCTTAGATAATTCCTAATAAAAAAAGGGTAAGTAAATGGCTGCTAATATGGACAACATAAATGTAGAAGGATAAACGTTTGAATAGAATTACAAATTATTTTCTCTAAGATGTTCAATATTAGAATAAGAAAAGGATGAAATACTTGAATAGATAAATAAATAATAATCAACTATATAAACTCATTCAGCAGTAATTGAATCTCTATAAAAACAAAAATCTACAGTGCAATAAAAATTATAAAAGCTCCAATAAGAATTATTGTTAGTTGAAAATTTTATCGACTAAAACTCTAAGGCTCTTGATGAGGCTGAACAAAATTTATCAAAAGAAACAGAAAAACTAGAACTTCTAAACTAAACATTAATTCCTTTGCAATCAGAAAGATAAAAGTACATGATACTTTCCTAAAACTAAAAAAAATGA